ID: 1005877240

View in Genome Browser
Species Human (GRCh38)
Location 6:30020470-30020492
Sequence GTGAGCAGGAATACAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005877235_1005877240 24 Left 1005877235 6:30020423-30020445 CCAGTCTAAGCCCTGGAATGTGC No data
Right 1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG No data
1005877237_1005877240 14 Left 1005877237 6:30020433-30020455 CCCTGGAATGTGCGTGGCATCAA No data
Right 1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG No data
1005877238_1005877240 13 Left 1005877238 6:30020434-30020456 CCTGGAATGTGCGTGGCATCAAA No data
Right 1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005877240 Original CRISPR GTGAGCAGGAATACAACTGC TGG Intergenic
No off target data available for this crispr