ID: 1005881221

View in Genome Browser
Species Human (GRCh38)
Location 6:30062236-30062258
Sequence TGCCCTCGATGTGGTCATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005881209_1005881221 22 Left 1005881209 6:30062191-30062213 CCAGGCCTCCCTAACCCACCAGT 0: 1
1: 0
2: 1
3: 33
4: 235
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881212_1005881221 13 Left 1005881212 6:30062200-30062222 CCTAACCCACCAGTTTCTTCCCA 0: 1
1: 0
2: 2
3: 37
4: 294
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881210_1005881221 17 Left 1005881210 6:30062196-30062218 CCTCCCTAACCCACCAGTTTCTT 0: 1
1: 0
2: 0
3: 20
4: 294
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881211_1005881221 14 Left 1005881211 6:30062199-30062221 CCCTAACCCACCAGTTTCTTCCC 0: 1
1: 0
2: 2
3: 23
4: 233
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881216_1005881221 4 Left 1005881216 6:30062209-30062231 CCAGTTTCTTCCCAGGTTGACAG 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881218_1005881221 -6 Left 1005881218 6:30062219-30062241 CCCAGGTTGACAGGCGCTGCCCT 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881219_1005881221 -7 Left 1005881219 6:30062220-30062242 CCAGGTTGACAGGCGCTGCCCTC 0: 1
1: 0
2: 1
3: 9
4: 158
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881215_1005881221 7 Left 1005881215 6:30062206-30062228 CCACCAGTTTCTTCCCAGGTTGA 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881214_1005881221 8 Left 1005881214 6:30062205-30062227 CCCACCAGTTTCTTCCCAGGTTG 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005881221 Original CRISPR TGCCCTCGATGTGGTCATGA AGG Exonic