ID: 1005881221

View in Genome Browser
Species Human (GRCh38)
Location 6:30062236-30062258
Sequence TGCCCTCGATGTGGTCATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005881212_1005881221 13 Left 1005881212 6:30062200-30062222 CCTAACCCACCAGTTTCTTCCCA 0: 1
1: 0
2: 2
3: 37
4: 294
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881210_1005881221 17 Left 1005881210 6:30062196-30062218 CCTCCCTAACCCACCAGTTTCTT 0: 1
1: 0
2: 0
3: 20
4: 294
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881219_1005881221 -7 Left 1005881219 6:30062220-30062242 CCAGGTTGACAGGCGCTGCCCTC 0: 1
1: 0
2: 1
3: 9
4: 158
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881216_1005881221 4 Left 1005881216 6:30062209-30062231 CCAGTTTCTTCCCAGGTTGACAG 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881218_1005881221 -6 Left 1005881218 6:30062219-30062241 CCCAGGTTGACAGGCGCTGCCCT 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881209_1005881221 22 Left 1005881209 6:30062191-30062213 CCAGGCCTCCCTAACCCACCAGT 0: 1
1: 0
2: 1
3: 33
4: 235
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881215_1005881221 7 Left 1005881215 6:30062206-30062228 CCACCAGTTTCTTCCCAGGTTGA 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881214_1005881221 8 Left 1005881214 6:30062205-30062227 CCCACCAGTTTCTTCCCAGGTTG 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1005881211_1005881221 14 Left 1005881211 6:30062199-30062221 CCCTAACCCACCAGTTTCTTCCC 0: 1
1: 0
2: 2
3: 23
4: 233
Right 1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005881221 Original CRISPR TGCCCTCGATGTGGTCATGA AGG Exonic
904301765 1:29558765-29558787 TGCCCTAGAGGTGCTCATCAGGG - Intergenic
905552914 1:38858728-38858750 AGCCCTCCATTTGTTCATGAAGG + Intronic
905589969 1:39154765-39154787 TGCCTGAGATGTGGTCCTGAGGG - Intronic
908609554 1:65842026-65842048 TCCCTTCGATGTAGTCATGGAGG + Intronic
910807662 1:91204756-91204778 TGCCCTCCTGGTGGTAATGAAGG - Intergenic
912369401 1:109161983-109162005 TGCCCTTGATGGGGTCAGGCAGG - Exonic
915501390 1:156320901-156320923 TGCCCTGGATGCTGTCAAGATGG - Exonic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
919928878 1:202208542-202208564 AGCCCTCGAGGTGCTGATGATGG - Intronic
921422911 1:214969221-214969243 TGCCTTCCATCAGGTCATGAAGG + Intergenic
922741542 1:228016881-228016903 TGCCCTCCCTGCGGTAATGAGGG - Intronic
922767518 1:228163580-228163602 GGCCCTGGATGTGGCCATGGAGG - Intergenic
923256226 1:232223856-232223878 TGCCTCCCTTGTGGTCATGAAGG + Intergenic
1064190792 10:13203926-13203948 TGCCCTTGCTGTTGTCATCATGG + Intronic
1067043043 10:42968000-42968022 TGGCGTGGATGTGGTGATGAGGG - Intergenic
1068748954 10:60569244-60569266 TAACCTCGAAGTGGTCATCATGG - Intronic
1076874543 10:133209664-133209686 TGGCCGTGATGTGGTCACGAGGG + Intronic
1078628364 11:12979263-12979285 TTCCAGCTATGTGGTCATGATGG + Intergenic
1087821568 11:102718429-102718451 TGCCATCGATGTCATCTTGAGGG + Exonic
1088597373 11:111450420-111450442 CCCCCTCTATGTGGTCAAGATGG + Intronic
1091063936 11:132491182-132491204 TCCCCTCGGTGTGCTCATCACGG + Intronic
1098951670 12:76645838-76645860 TGCCCTCAATGTGGTGAGTAAGG - Intergenic
1101837785 12:108307216-108307238 TGCTCAGGATGTGGTCAAGAAGG + Intronic
1101914708 12:108887198-108887220 TGCACTCCATATGGTTATGATGG + Intronic
1109669612 13:65587138-65587160 TGCCCTAGAAGAGGTCCTGAAGG + Intergenic
1115680726 14:35735069-35735091 TGGCATGGATGTGGTCATCAGGG + Intronic
1119741328 14:77015452-77015474 TGCCCTGGATGTGGGCCTGTGGG + Intergenic
1129913583 15:79248089-79248111 GGCCCTAGATGTGGACATCAGGG + Intergenic
1130517601 15:84637908-84637930 TGCCATGGCTGTGGTAATGAGGG + Intergenic
1139751185 16:69109737-69109759 TGACCTCAAGGTGGTCATGGTGG + Exonic
1142737074 17:1907843-1907865 TGCCCTCGTTGTGTTCATAATGG - Intergenic
1143167208 17:4902761-4902783 TGCCTGCGATGGGGTCAAGAAGG + Exonic
1144621288 17:16820133-16820155 AGCCCTCACTGTGGTCAGGATGG - Intergenic
1147573263 17:41584447-41584469 AGCCCTCGCTGTGATCAGGATGG - Intronic
1151215331 17:72573125-72573147 TGCCCTCGATGAGGTTGTAAGGG + Intergenic
1151408895 17:73907663-73907685 CGGCCTCCATGTGGTGATGAGGG - Intergenic
1155981431 18:32184360-32184382 TGCCTTTGATGTAATCATGAGGG + Intronic
1157429832 18:47615552-47615574 TACCCCCAATGTGGTCATTAGGG + Intergenic
1160542295 18:79630745-79630767 GGCCCTCGCTGTGGTTTTGATGG - Intergenic
1163429208 19:17256889-17256911 TGGCCACCATGTGGTCTTGATGG - Intronic
1163621702 19:18364717-18364739 TGCCCCAGATGTGGCCATGGGGG + Exonic
1163681223 19:18683780-18683802 GGCCTTCGAGGAGGTCATGAAGG + Exonic
1168269709 19:55242719-55242741 AGCCCTGTATGCGGTCATGAGGG - Intronic
928394509 2:30933216-30933238 TGCCCTCGCTGTGGTCAGTTAGG - Intronic
930025969 2:47029334-47029356 TGCCCTGGATGTTGTCAACATGG + Exonic
930355407 2:50312368-50312390 GGCACTTGATGTGGGCATGACGG + Intronic
937426780 2:121806581-121806603 TGGGCTCGATGTAATCATGAGGG + Intergenic
937989830 2:127656015-127656037 TGACATCGATGTGGACTTGAGGG + Intronic
942921315 2:181376690-181376712 TGCCCTCCAATTGGTCATTATGG + Intergenic
945135487 2:206623217-206623239 TTCCACCGATGTGCTCATGATGG + Intergenic
948741325 2:240048423-240048445 TGCACTTGCTGTGTTCATGAGGG + Intergenic
1173272240 20:41547868-41547890 TGCCATCCATGATGTCATGAGGG - Intronic
1174304402 20:49604957-49604979 TGACCTAGAGGTGGTCACGAGGG - Intergenic
954682553 3:52353564-52353586 TGCTCTCGATATGGTCCTGCAGG - Exonic
954868623 3:53750284-53750306 TGCCCTCGATTTAGAGATGAGGG - Intronic
960631568 3:119737182-119737204 TGACCTAGATCTGGTAATGAAGG + Intronic
970163939 4:13216343-13216365 TGCCCTCAAAGTTGTCATGGGGG + Intergenic
970224376 4:13842301-13842323 TGCCTTCTCTGTGGTGATGAGGG + Intergenic
972411132 4:38795958-38795980 TGCCCTTTGTGTGGGCATGATGG + Intronic
978114516 4:105003350-105003372 TACCTTCAATGAGGTCATGATGG - Intergenic
986000402 5:3626749-3626771 TGACCTTGATGTGTTCTTGAGGG - Intergenic
988698433 5:33647948-33647970 TGCCCTCGAGGAGCTCATGGTGG - Intronic
991499198 5:67259365-67259387 TGCCTTCAAGGTGGTGATGAGGG + Intergenic
992017688 5:72592548-72592570 TGCCCAAGATGTGGCCATGGGGG + Intergenic
993642978 5:90428222-90428244 TGCTCTTGATGTTGCCATGATGG - Intergenic
1005061546 6:21781356-21781378 TGACCTCGAGGTGCTAATGAGGG - Intergenic
1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG + Exonic
1011057186 6:83218099-83218121 TGCCCTAGAATTGGTCATCAGGG + Intronic
1011217727 6:85022857-85022879 TGTCATCCATGTGTTCATGAAGG + Intergenic
1012021542 6:93927741-93927763 TGCCATCCCTGTGGTAATGAAGG + Intergenic
1014673656 6:124338141-124338163 TGCCTTCGAAGTGGTCAAAATGG + Intronic
1015870412 6:137770506-137770528 TCCCATTCATGTGGTCATGAGGG + Intergenic
1018570739 6:165206936-165206958 TGGCCTCAATGTGGCCATGTGGG + Intergenic
1018804128 6:167245788-167245810 TGCCCTGGATCTGTTCCTGAAGG + Intergenic
1019643221 7:2115691-2115713 TTCCCTGGATGTGGCCATGCGGG - Intronic
1022185576 7:27964339-27964361 TGCCCTTCATTTCGTCATGATGG - Intronic
1026324608 7:69298113-69298135 TATTCTCGATGTGCTCATGAGGG + Intergenic
1027448944 7:78307591-78307613 TGCCCCAGATGAGGTCAGGAAGG + Intronic
1033062644 7:138122995-138123017 TGCCCTCAATGTGGTCAGCTGGG + Intergenic
1033804799 7:144941349-144941371 TTCCCTGGAGGTGGTCAGGAGGG + Intergenic
1034575223 7:151990839-151990861 AGCCCTCCATGTGGTCATTCAGG - Intronic
1035985355 8:4424724-4424746 TGCCCTAGAAATGCTCATGATGG + Intronic
1040635231 8:49265451-49265473 TGGCATGGATGTGGTCATCAGGG - Intergenic
1042504216 8:69542405-69542427 TGTCCCCAGTGTGGTCATGATGG + Intronic
1042825451 8:72974951-72974973 TGCCCAAGTTGTGGTGATGAAGG + Intergenic
1049592340 8:143468350-143468372 TGCCCTCGCTGTGGGCCTGGGGG - Intronic
1049931160 9:458267-458289 TTGCCTAGATGTGGTCATGATGG - Intronic
1049931304 9:459560-459582 TGCCTATGATGTGGTCATGATGG + Intronic
1050702376 9:8355120-8355142 TGCCCTCACGGTGGTAATGAGGG + Intronic
1056305232 9:85283952-85283974 TTCCCTCAATGTTGTCAAGATGG - Intergenic
1057599909 9:96449312-96449334 TGCGCTAGAGGTGGTGATGAGGG - Intergenic
1062526091 9:136978633-136978655 TTCCCTGGTTGTGGACATGAAGG + Intronic