ID: 1005882933

View in Genome Browser
Species Human (GRCh38)
Location 6:30074404-30074426
Sequence AAGGAGCCGGGGCCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 1, 2: 6, 3: 48, 4: 444}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005882922_1005882933 18 Left 1005882922 6:30074363-30074385 CCAGGGGTCGGTCGGGCAAGGGA 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1005882933 6:30074404-30074426 AAGGAGCCGGGGCCCAGGAGAGG 0: 1
1: 1
2: 6
3: 48
4: 444
1005882915_1005882933 27 Left 1005882915 6:30074354-30074376 CCCAGACGCCCAGGGGTCGGTCG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1005882933 6:30074404-30074426 AAGGAGCCGGGGCCCAGGAGAGG 0: 1
1: 1
2: 6
3: 48
4: 444
1005882916_1005882933 26 Left 1005882916 6:30074355-30074377 CCAGACGCCCAGGGGTCGGTCGG No data
Right 1005882933 6:30074404-30074426 AAGGAGCCGGGGCCCAGGAGAGG 0: 1
1: 1
2: 6
3: 48
4: 444
1005882920_1005882933 19 Left 1005882920 6:30074362-30074384 CCCAGGGGTCGGTCGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1005882933 6:30074404-30074426 AAGGAGCCGGGGCCCAGGAGAGG 0: 1
1: 1
2: 6
3: 48
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005882933 Original CRISPR AAGGAGCCGGGGCCCAGGAG AGG Intronic