ID: 1005883092

View in Genome Browser
Species Human (GRCh38)
Location 6:30075000-30075022
Sequence CACTTGGTCCACAGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005883092_1005883107 28 Left 1005883092 6:30075000-30075022 CCTCCTCCCCTGTGGACCAAGTG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 1005883107 6:30075051-30075073 CCTCTCACCTTGAGGACCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 202
1005883092_1005883103 20 Left 1005883092 6:30075000-30075022 CCTCCTCCCCTGTGGACCAAGTG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 1005883103 6:30075043-30075065 TCCGGGCGCCTCTCACCTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 74
1005883092_1005883099 3 Left 1005883092 6:30075000-30075022 CCTCCTCCCCTGTGGACCAAGTG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 1005883099 6:30075026-30075048 ACTCCATCCATCGTCCTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 131
1005883092_1005883098 2 Left 1005883092 6:30075000-30075022 CCTCCTCCCCTGTGGACCAAGTG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 1005883098 6:30075025-30075047 AACTCCATCCATCGTCCTTCCGG 0: 1
1: 0
2: 0
3: 4
4: 81
1005883092_1005883105 27 Left 1005883092 6:30075000-30075022 CCTCCTCCCCTGTGGACCAAGTG 0: 1
1: 0
2: 1
3: 29
4: 266
Right 1005883105 6:30075050-30075072 GCCTCTCACCTTGAGGACCCAGG 0: 1
1: 0
2: 4
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005883092 Original CRISPR CACTTGGTCCACAGGGGAGG AGG (reversed) Intronic
900571146 1:3358872-3358894 CTCTTGGGCCGCAGAGGAGGTGG + Intronic
900576065 1:3383024-3383046 CCTGTGGTCCACAGGGGACGTGG - Intronic
901057164 1:6453987-6454009 GGCTTGGGCCACAGGGGAGCTGG + Intronic
902076423 1:13790414-13790436 CACTTGGTGGAAAGAGGAGGTGG + Intronic
902477202 1:16694506-16694528 GGCTTGGGCCACAGGGGAGCTGG - Intergenic
902809286 1:18879259-18879281 CCCTGGGGCCACACGGGAGGAGG + Intronic
903659822 1:24970163-24970185 CTCTTGTACCACAGGGGTGGTGG + Intergenic
904145844 1:28390707-28390729 CACTTGAACCCCAGGGGTGGAGG + Intronic
905395863 1:37665981-37666003 CACCTGGTCTAGAGGGGATGGGG + Intergenic
905839041 1:41158111-41158133 CACCTGGTCCTCAGGTGATGTGG - Intronic
907238482 1:53067424-53067446 CACTGGGGACACAGGTGAGGTGG - Intronic
907390996 1:54158205-54158227 CTCCTGGTCCCCAGGGGAGGTGG + Intronic
908226020 1:62056695-62056717 CACTTGAACCCCAGGGGCGGAGG + Intronic
910902978 1:92142624-92142646 CACATGGTCCACAGCGAAGGAGG + Intronic
912934139 1:113988051-113988073 CCCTGAGGCCACAGGGGAGGAGG + Intergenic
914806396 1:150995205-150995227 CACTTGGGCCATAGTGGTGGTGG + Intronic
914829378 1:151159557-151159579 TCCTTGGTTCACATGGGAGGGGG - Exonic
915502772 1:156330828-156330850 CACTTGAACCCCAGGGGTGGAGG + Intronic
915849918 1:159310400-159310422 CTCTTGGTCCAGAGGGAATGTGG + Intergenic
916350340 1:163842387-163842409 CACTTAGTCTACATGGGATGGGG - Intergenic
916526987 1:165619707-165619729 CACTTGGGCCACAGAGCAGCTGG - Intergenic
917095546 1:171395399-171395421 CACTTGAACCCCAGAGGAGGAGG + Intergenic
917122224 1:171654830-171654852 CAGCTGAGCCACAGGGGAGGTGG - Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
919402603 1:197138384-197138406 CACTTGGGCCCCAGAGGTGGAGG - Intronic
920258609 1:204673917-204673939 CACTTGGTCCTGTGGGGAGAGGG - Intronic
921291090 1:213658320-213658342 CATTTGGCCCACAGGGAAAGAGG + Intergenic
921790502 1:219284758-219284780 CCCATGGTCCACAGGAGAGTTGG + Intergenic
924626935 1:245703434-245703456 CACCTGCAGCACAGGGGAGGAGG + Intronic
924738253 1:246778755-246778777 CACAGGGTCCACACGGCAGGTGG + Intergenic
1063582160 10:7317695-7317717 GACCTGGTCCACAGAGGAGAAGG + Intronic
1063995836 10:11618348-11618370 CACTGGGTCCACAGGTGATATGG - Intergenic
1066059514 10:31709399-31709421 CCCTAGGTCCACAGGGTAGAGGG + Intergenic
1067064518 10:43096239-43096261 GCCTTGGTCCACAGGCCAGGCGG + Intronic
1068511620 10:57973008-57973030 CACTTCCTCCTCAGGGGAGTGGG - Intergenic
1069431205 10:68336165-68336187 AACTTTGTTTACAGGGGAGGAGG + Intronic
1069896877 10:71685510-71685532 CCCTGGGACCACAGAGGAGGTGG + Intronic
1072482848 10:95826487-95826509 CACTTGGGCCCCAGAGGCGGAGG + Intronic
1072782863 10:98262026-98262048 CCCTTGGGCCCCAGGTGAGGAGG - Exonic
1073254645 10:102142923-102142945 CACTTAGTACAGAGGGCAGGGGG + Intronic
1073349806 10:102811592-102811614 CACTTGAACCCCAGAGGAGGAGG - Intronic
1073394409 10:103206344-103206366 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1073683363 10:105728488-105728510 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1073754475 10:106566220-106566242 GATATGGTACACAGGGGAGGTGG - Intergenic
1076562561 10:131376808-131376830 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562578 10:131376867-131376889 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562595 10:131376926-131376948 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562612 10:131376985-131377007 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562629 10:131377044-131377066 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562646 10:131377103-131377125 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562663 10:131377162-131377184 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562680 10:131377221-131377243 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1077257915 11:1597285-1597307 CACTTGGGCCACAGGAGAACAGG + Exonic
1077665381 11:4103704-4103726 CATTTGATCCCCAGGGGTGGAGG - Intronic
1079490990 11:20989213-20989235 CACGTGTTCCACAGGGGATTAGG - Intronic
1081587804 11:44399073-44399095 CACCTGGCCCATAGGGCAGGAGG + Intergenic
1081864667 11:46352881-46352903 CACTTGGGTCACAGGTGTGGAGG + Intronic
1083199765 11:61113423-61113445 CACGTGGTCCACATGGGGGAAGG + Intronic
1083420364 11:62549060-62549082 CTCTTGGTCAACAGGGAAGAAGG + Intronic
1084004683 11:66316697-66316719 CACGTGGACCACAGGGGACCAGG - Exonic
1084169087 11:67391924-67391946 CACGTGGACCAATGGGGAGGCGG + Intronic
1084174142 11:67415069-67415091 CACTGGGTCCAGAAGTGAGGAGG + Intronic
1084476486 11:69392301-69392323 CTCCTGGACCACAGGGGAGGAGG + Intergenic
1084589126 11:70079861-70079883 CCCTTGGGTCACAGTGGAGGGGG + Intronic
1085911708 11:80834705-80834727 CACTTGAGCCCCAGGGGTGGAGG - Intergenic
1087049359 11:93869783-93869805 GAGTAGGTCCACAGGGGATGTGG + Intergenic
1087128748 11:94651265-94651287 CAGTAGGTCCTCAGTGGAGGAGG + Intergenic
1087921794 11:103875485-103875507 CACTTGAACCCCAGGGGCGGAGG - Intergenic
1088457789 11:110050460-110050482 CACTGGGTCCACAGTGTTGGGGG + Intergenic
1088977689 11:114830351-114830373 CACTTTGTCTGGAGGGGAGGAGG + Intergenic
1089162925 11:116453293-116453315 CCCTTTGTCCCCAGAGGAGGTGG - Intergenic
1089281723 11:117379415-117379437 CACAGGGTCAACAGGAGAGGTGG - Intronic
1090500288 11:127254457-127254479 CACTTATACCTCAGGGGAGGAGG + Intergenic
1090788583 11:130070372-130070394 CACTGGGTCCCCGGAGGAGGTGG - Intronic
1091398099 12:166256-166278 GACTTGGGCCACAGTGGGGGAGG - Intronic
1092092713 12:5816766-5816788 CAGTTGGGACACAGGGGAGGAGG - Intronic
1093237355 12:16627872-16627894 CACTTGGTCCACAGTGGCTTTGG - Intergenic
1095877621 12:47099065-47099087 CACCTGGTTCGCAGGGGAGAAGG - Intronic
1099742867 12:86663720-86663742 AACATGGTGCATAGGGGAGGGGG - Intronic
1101503108 12:105322148-105322170 TACTTTGTCCACAGTGGAAGAGG - Intronic
1101516586 12:105441352-105441374 CACTTGGATCACAAGGCAGGTGG - Intergenic
1102259887 12:111437370-111437392 CCCTTTCCCCACAGGGGAGGAGG - Intronic
1103281252 12:119759728-119759750 CAATTTTTCCACAGGGGTGGGGG - Intronic
1103318662 12:120077367-120077389 CACTTGGGGAACAGAGGAGGAGG - Intronic
1103965890 12:124639108-124639130 CTCTGGGACCTCAGGGGAGGAGG + Intergenic
1108582511 13:51839171-51839193 CAGCAGGTCCACAGGGGAGCCGG - Intergenic
1109335709 13:60991050-60991072 CCTTTGGTCCACAGGGGAGAAGG - Intergenic
1112256091 13:97832578-97832600 CACTGGGTGCAAAGGGGAGGTGG - Intergenic
1112812644 13:103235987-103236009 CAATTGGCCCACAGGGTAAGAGG - Intergenic
1114596665 14:23918079-23918101 CACTTGGTCAAAAGTGCAGGTGG + Intergenic
1118427921 14:65687700-65687722 CACTTGGTGCAGGGGGTAGGGGG - Intronic
1119809015 14:77500537-77500559 CACTTGGTGCCCAGGTGAGAGGG - Intergenic
1119903104 14:78278055-78278077 CACTGGGTGTACTGGGGAGGCGG + Intronic
1120984478 14:90321964-90321986 CTGTTGGTCTATAGGGGAGGAGG - Intronic
1121864265 14:97347669-97347691 CTCAGGGACCACAGGGGAGGTGG + Intergenic
1122487872 14:102093888-102093910 CACTTGAACCTGAGGGGAGGAGG + Intronic
1122671352 14:103375094-103375116 CACTTGGACCTCAGAGGCGGTGG - Intergenic
1123581100 15:21715525-21715547 CACTTGGTGAACAGAGGATGGGG - Intergenic
1123617749 15:22158148-22158170 CACTTGGTGAACAGAGGATGGGG - Intergenic
1123708629 15:22969138-22969160 CATTTGCATCACAGGGGAGGGGG - Intronic
1129856765 15:78830505-78830527 CTCGGGGCCCACAGGGGAGGTGG + Intronic
1129878856 15:78994246-78994268 CACGTGGTCCACAGGCAGGGAGG - Intronic
1130796791 15:87218182-87218204 CACTTGGTCCAATGGGGAAGTGG - Intergenic
1131385470 15:92003059-92003081 CACAGGGTTCACAGGGGAGGCGG - Intronic
1133064212 16:3194622-3194644 CACTCGGGCCAGAGGAGAGGAGG + Intergenic
1133306737 16:4814448-4814470 CACTTGGTGTGCAGGGGAGGAGG + Intronic
1133465120 16:6020548-6020570 CACCTCGACCCCAGGGGAGGGGG + Intronic
1136367321 16:29814732-29814754 CCCTTGGTCCTTAGGGGTGGGGG - Intronic
1136524434 16:30819893-30819915 CACTTGAACCACAGAGGCGGAGG - Intergenic
1137649995 16:50111507-50111529 CACTTGAACCCCAGAGGAGGAGG - Intergenic
1138005347 16:53330700-53330722 CACATGGACACCAGGGGAGGGGG - Intergenic
1139079968 16:63505788-63505810 CTCTTGTTCCACAGGGGTGCTGG - Intergenic
1139487494 16:67266245-67266267 AGCTTGCTCCAGAGGGGAGGTGG - Intronic
1140656259 16:77143265-77143287 CTTTTGTTCCACAGGGGAGAAGG - Intergenic
1141595775 16:85095953-85095975 CACTGGGGCCAAAGGGGAAGGGG + Intergenic
1142035027 16:87857360-87857382 CACTTGATCCCCAGAGGCGGAGG - Intronic
1143039746 17:4025085-4025107 CAGCTGGTCCAGAAGGGAGGAGG - Exonic
1143045757 17:4078003-4078025 CAGTGGGGCCCCAGGGGAGGTGG - Exonic
1144949205 17:18984971-18984993 CTCCTGGTCCCCAGGTGAGGTGG - Intronic
1145948612 17:28797971-28797993 CACTTGAGCCCCAGGGGTGGAGG + Intronic
1147304574 17:39554408-39554430 CACCTGGCACACAAGGGAGGAGG - Intronic
1148367533 17:47067509-47067531 CACTTCCTGTACAGGGGAGGGGG - Intergenic
1148724568 17:49779456-49779478 CCCTTTGTCCACATGGGTGGGGG - Intronic
1149543809 17:57488414-57488436 CACTTGGCCCAAAAGGTAGGTGG - Intronic
1150299977 17:64039801-64039823 CACACAGTACACAGGGGAGGTGG + Exonic
1151546741 17:74797907-74797929 CCCTTGGGCCCCAGAGGAGGAGG + Intronic
1151661937 17:75523819-75523841 CACTTGGTTCACAGGAGAACTGG - Intronic
1152359538 17:79825016-79825038 CCCTAGGTCCACAGGGGAGTAGG - Intergenic
1152588005 17:81197631-81197653 CACCTGGCCCTCGGGGGAGGAGG - Intronic
1152590144 17:81207692-81207714 CTCTTGGTTCACAGGGAAGAGGG - Intronic
1152607493 17:81300100-81300122 CACCAGGTCCACAGAAGAGGTGG - Intergenic
1153712867 18:7817966-7817988 CAGATGGTACACAGGGAAGGTGG + Intronic
1157564132 18:48668342-48668364 CGCCTGGGCCATAGGGGAGGAGG - Intronic
1157811234 18:50697685-50697707 CACTTGGGCCACAGAGGGGAAGG + Intronic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1159103659 18:63982050-63982072 AGCACGGTCCACAGGGGAGGAGG - Intronic
1159282948 18:66310618-66310640 CTCTAGGTGCACAGAGGAGGGGG + Intergenic
1159884986 18:73895309-73895331 CACTTGGTGGGCAGGGCAGGGGG + Intergenic
1160039907 18:75336173-75336195 GACTTGTTACACAGGGGAGAGGG + Intergenic
1160352251 18:78193642-78193664 CACTTGGTAAAAAGGGGAGGGGG - Intergenic
1160807385 19:998452-998474 CACTTGTTCCACATGGCAGCTGG + Intergenic
1161757566 19:6145517-6145539 AACCTGGTCTACTGGGGAGGTGG - Intronic
1161992141 19:7690150-7690172 CACGTGGACTACAGGTGAGGAGG - Exonic
1162110259 19:8396228-8396250 CCCTTGGGCCACAGGTGAGGAGG - Intronic
1162806272 19:13139424-13139446 CCCTCGGTCCCCAGGGGTGGGGG + Exonic
1164204491 19:23046780-23046802 AACCTGGTCCACAGGGGGGTTGG - Intergenic
1167367397 19:49061931-49061953 CAATTGGCACACTGGGGAGGAGG + Exonic
1167624136 19:50575868-50575890 CACTTGGACCCCAGAGGCGGAGG + Intergenic
1167912286 19:52713805-52713827 CACTTGATCCTGAGGGGCGGAGG + Intronic
1168003900 19:53470191-53470213 CTCTTGTTCTAAAGGGGAGGAGG + Intronic
1168653609 19:58110704-58110726 AACTTGGACCACAGTGGTGGAGG - Intronic
1202711218 1_KI270714v1_random:20332-20354 GGCTTGGGCCACAGGGGAGCTGG - Intergenic
925407162 2:3613297-3613319 GACTTCTTCCACAGGGGATGCGG + Exonic
926250526 2:11153280-11153302 CATTTGTTCCACAATGGAGGAGG + Intergenic
927469663 2:23363443-23363465 CACATGGCTCCCAGGGGAGGAGG + Intergenic
927868706 2:26609628-26609650 CTCTTGGGCCAGAGAGGAGGAGG + Intronic
928329346 2:30345956-30345978 CACTTGAACCCCCGGGGAGGCGG + Intergenic
930236965 2:48897792-48897814 TACTTGCTCCAAAAGGGAGGAGG + Intergenic
933984105 2:87576177-87576199 CACTTGCTCCAAGTGGGAGGTGG + Intergenic
935652013 2:105390411-105390433 CAGTGGGTCCACCTGGGAGGAGG + Intronic
936309749 2:111374619-111374641 CACTTGCTCCAAGTGGGAGGTGG - Intergenic
936708208 2:115101024-115101046 AGCTTGGTTCACAGGGGAGTTGG - Intronic
938087702 2:128412208-128412230 CACTGGGTGGTCAGGGGAGGTGG + Intergenic
938209874 2:129458617-129458639 CACATGGTCCCCAGGGAGGGAGG + Intergenic
938391970 2:130914044-130914066 CACTTGTTCTGCAGGGGATGTGG - Intronic
945991629 2:216400193-216400215 CACTTGATCAACTGGGGTGGTGG + Intergenic
946345794 2:219109491-219109513 CTCTGGGTCCCCAAGGGAGGGGG - Intronic
947038855 2:225891848-225891870 TGCTTGGTCCACAGGGCAGCTGG + Intergenic
947732286 2:232438001-232438023 CACTTGGGCCACCAGGGAGGTGG + Intergenic
948421476 2:237863119-237863141 CCCTGGGTCCCCAGTGGAGGAGG - Intronic
948428473 2:237902943-237902965 AAAATGGTCCACATGGGAGGGGG - Intronic
948807555 2:240459561-240459583 CACCTGGTCCCCAGGGGCAGTGG - Intronic
948824251 2:240566703-240566725 CCCTTGGGCCCCCGGGGAGGAGG + Intronic
948915920 2:241035057-241035079 TTCTGGGTCCTCAGGGGAGGAGG + Intronic
1172323584 20:34017028-34017050 CTGCTGGTCCCCAGGGGAGGTGG - Intronic
1174896816 20:54458031-54458053 CACTTGGTCTGATGGGGAGGTGG + Intergenic
1175958426 20:62623023-62623045 CACTCGGTCACCAGGGGAGGCGG + Intergenic
1176075032 20:63244511-63244533 GGCTTGCTCCACAGAGGAGGAGG - Intronic
1181155621 22:20918059-20918081 CACATAGTCCCCAGGGCAGGTGG - Exonic
1181533687 22:23531112-23531134 CACTGGGTCCTGAGGGCAGGTGG + Intergenic
1182422016 22:30253358-30253380 CACATGGTTCCCAGGGGCGGGGG - Intergenic
1182649467 22:31839521-31839543 CACTAGGTGATCAGGGGAGGGGG - Intronic
1182931233 22:34176201-34176223 CATTTGTTCAACAAGGGAGGTGG + Intergenic
1183000875 22:34857605-34857627 CACTGGGGCCTGAGGGGAGGTGG - Intergenic
1183099069 22:35572470-35572492 ACCTTGGGGCACAGGGGAGGAGG - Intergenic
1183104935 22:35608896-35608918 CAATCTGTCCACAGGTGAGGTGG + Intronic
1184140756 22:42576319-42576341 CACATGGTCTACAGTGGAGAAGG - Intergenic
951495895 3:23326153-23326175 CACTTGAACCCCAGGGGTGGAGG - Intronic
952161754 3:30700848-30700870 CAGTTGGAACAAAGGGGAGGGGG + Intergenic
953135790 3:40180723-40180745 CACTTGGTTCACAGCTTAGGGGG + Intronic
953454250 3:43029468-43029490 CTCTTGGTGGACAGTGGAGGTGG - Intronic
954610918 3:51944069-51944091 CACCTGGGCCAGAGGGGAGGTGG - Exonic
954627347 3:52029727-52029749 GACCTGGTCCACAGGGCAGCAGG - Intergenic
954741929 3:52759315-52759337 CACTTGATCCAGAGAGGTGGAGG + Intronic
954752998 3:52824142-52824164 GACGTGCTGCACAGGGGAGGCGG - Intronic
955534576 3:59909411-59909433 CACTTGAACCCCAGAGGAGGAGG - Intronic
959193761 3:103150329-103150351 CAGATTGTCCACATGGGAGGTGG - Intergenic
960992199 3:123319268-123319290 CACTTGAACCTCGGGGGAGGAGG + Intronic
961314224 3:126023463-126023485 CAGTTAGGGCACAGGGGAGGGGG + Intronic
961828981 3:129613586-129613608 CACTTGCTCTGCAGGGGTGGGGG - Intergenic
961862553 3:129928247-129928269 CTCTTGGTCACCAGGGGAAGCGG - Intergenic
962724009 3:138204175-138204197 CGCTTGATCCACAGAGGCGGAGG - Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
966602221 3:181787229-181787251 CACGAGGTCCACCTGGGAGGCGG - Intergenic
967042986 3:185710780-185710802 TACTTGCTCCAGAGAGGAGGAGG + Intronic
968461899 4:730373-730395 CACGTGGCCCACGGGGGTGGGGG - Intronic
968663053 4:1806706-1806728 CACTGGGTCCTCAGGGGTGGGGG + Intronic
968754751 4:2409468-2409490 CACTTGGAGCACAGGGGACAAGG - Intronic
968915076 4:3493770-3493792 CACCTGATCCTCAGGGGTGGGGG - Exonic
968963907 4:3759820-3759842 CACTGGGTCCACAGGTGTCGTGG + Intergenic
969043065 4:4316223-4316245 CTCTTGGTCCAGATGGGAAGAGG + Intronic
969591788 4:8126362-8126384 CAGGGGGTACACAGGGGAGGGGG - Intronic
972265113 4:37452594-37452616 CCCTTGATCCCCAGAGGAGGAGG + Intergenic
977306273 4:95327657-95327679 CACTGGGGCTACAGGGGAAGAGG - Intronic
977917912 4:102614179-102614201 CACTTGGTGCAAAGGTGAGAGGG - Intronic
979051046 4:115933794-115933816 CACTTGAACCCCAGGGGCGGAGG - Intergenic
980069314 4:128226708-128226730 CACGTGGAACACAAGGGAGGAGG - Intergenic
982302305 4:153892223-153892245 CACTTGGTCCAGAGGGCATTTGG - Intergenic
985557871 5:566293-566315 CACGTAGTCTCCAGGGGAGGAGG + Intergenic
985641529 5:1065566-1065588 TGCTGGGTCCACAGGGGAGGTGG - Intronic
986340423 5:6784471-6784493 TACCTGGGCCTCAGGGGAGGAGG + Intergenic
986468117 5:8047396-8047418 CACATGGCCCACATGGGAGGTGG + Intergenic
987427674 5:17792257-17792279 CACCTTCTCCACAGGGCAGGAGG - Intergenic
992524863 5:77599282-77599304 CACTTGATCCCCAGAGGCGGAGG - Intronic
996441602 5:123497687-123497709 CACTTGAACCACGGAGGAGGAGG - Intergenic
1002342220 5:178524609-178524631 CAGGTGGTCCATGGGGGAGGAGG - Intronic
1002719949 5:181252755-181252777 CACTGAGTCCACAGTGGAGGTGG - Intergenic
1004481053 6:16019552-16019574 CACTTGGGCCGGAAGGGAGGAGG - Intergenic
1005883092 6:30075000-30075022 CACTTGGTCCACAGGGGAGGAGG - Intronic
1006014638 6:31070618-31070640 CAGTCTGTCCACTGGGGAGGGGG - Intergenic
1006131858 6:31874457-31874479 CACCTGGAGCAGAGGGGAGGAGG + Exonic
1006133671 6:31883247-31883269 CACTTCCCCCACAGGGTAGGAGG + Intronic
1006433266 6:34011422-34011444 CACTTAGTACACAGGGGGAGGGG + Intergenic
1006914620 6:37586226-37586248 AACTTGGCCCAGAGGGGAGAGGG + Intergenic
1008302130 6:49854176-49854198 CACTTGTACCACAGAAGAGGAGG - Intronic
1008459923 6:51756885-51756907 CAATTTTTCCACAGGGGAGGTGG + Intronic
1012052456 6:94362020-94362042 CACCAGGGCCACAGGGGAGCTGG - Intergenic
1013007484 6:106087514-106087536 CACTTGGACCACAGGAAAAGAGG - Intronic
1017628004 6:156367965-156367987 CCCTTTCTCCACAGGGCAGGTGG - Intergenic
1017821027 6:158049222-158049244 CCCTTTGCCCAGAGGGGAGGAGG + Intronic
1018736972 6:166694268-166694290 CACCTGGGCCACAGAGGAGCGGG + Intronic
1019378648 7:710241-710263 CATTTGGTCCCCAGGAGAGATGG + Intronic
1019650399 7:2154411-2154433 CAGTTGTTCCACAGAAGAGGAGG + Intronic
1020127503 7:5541242-5541264 CACTTGGCCGACAGGGGTGTGGG - Intronic
1021311396 7:19102254-19102276 CACTTGGTCCACAGTGCAAAGGG + Intronic
1021632478 7:22660660-22660682 CACTTGGACCAGATGGGACGGGG + Intergenic
1021785804 7:24151429-24151451 CATTTGTTTCACAGGGGAGAAGG + Intergenic
1022592054 7:31672979-31673001 CACTTTGTTCACAGGGAAGCAGG - Intergenic
1026260204 7:68748299-68748321 CGCTTGAACCCCAGGGGAGGAGG + Intergenic
1026529140 7:71182089-71182111 CACTTGAACCCCAGAGGAGGAGG + Intronic
1028509019 7:91601620-91601642 CACTTGAACCCCAGAGGAGGAGG - Intergenic
1028758606 7:94467341-94467363 CATTTTCTCCACAGGGGAAGGGG + Intergenic
1029212737 7:98922162-98922184 CTCTTGGTCACCAGGAGAGGGGG - Intronic
1031169687 7:118277041-118277063 CAATTTTTCCACAGAGGAGGTGG - Intergenic
1031894855 7:127337144-127337166 CACTTGATCCCCAGAGGTGGAGG - Intergenic
1032252892 7:130272968-130272990 CCCTTGGGACACAGCGGAGGGGG - Intronic
1032822238 7:135534700-135534722 CACTTGAACCAGAGGGGCGGAGG + Intergenic
1033269580 7:139918645-139918667 CATTTTATCCACTGGGGAGGAGG - Intronic
1034992673 7:155558077-155558099 CAATTTGTCCACAGTGGATGAGG - Intergenic
1038502318 8:28055418-28055440 CATGTGGTCCACAGAGGAGTAGG - Intronic
1041691608 8:60693311-60693333 GACTTGTTCCACAGGGGAGCAGG - Intronic
1042513393 8:69634675-69634697 CACTTGAGCCCCAGTGGAGGAGG + Intronic
1042642373 8:70950755-70950777 CACTTGATCCCCAGAGGTGGAGG - Intergenic
1045255237 8:100514703-100514725 CACTTGAGCCCCAGGGGTGGAGG - Intronic
1049112121 8:140653114-140653136 CACTTGAACCCCAGGGGTGGAGG - Intergenic
1049446457 8:142633700-142633722 CATACGGTCCACAGGGGACGGGG + Intergenic
1049584722 8:143427640-143427662 GACTGGGAGCACAGGGGAGGAGG - Intronic
1051086851 9:13359744-13359766 CACTTGAGCCACCTGGGAGGTGG + Intergenic
1052699863 9:31924600-31924622 CTCTTGGTTCACATGGAAGGCGG - Intergenic
1052777957 9:32752329-32752351 CACTTGAACCAGAGGGGTGGAGG + Intergenic
1052831777 9:33221580-33221602 TACCTGGTCCACAGCAGAGGTGG + Intronic
1052840405 9:33288284-33288306 CCCTCGGTCCCCAGGGGTGGGGG + Intergenic
1054826484 9:69578701-69578723 CAGTTGGTGGCCAGGGGAGGGGG - Intronic
1055452104 9:76440433-76440455 TATTTGCTCCACAGGTGAGGAGG + Intronic
1056269530 9:84933389-84933411 CTCTTGGTGCACAAGGCAGGAGG - Intronic
1057037020 9:91818503-91818525 CACCTGGACCCCAGGGGAGCTGG + Intronic
1057851817 9:98571950-98571972 CACATGGGGCACTGGGGAGGAGG - Intronic
1058435729 9:104961318-104961340 CACATGGTCCTCTGGGAAGGTGG + Intergenic
1059634916 9:116160948-116160970 CACTGGGGCCTCAGGGGAGAGGG + Intronic
1060574300 9:124675656-124675678 CACTAGGGCCACATGGGAAGTGG - Intronic
1060920108 9:127414465-127414487 CACTTGCCACCCAGGGGAGGTGG - Intergenic
1061059698 9:128244382-128244404 CACTAGGACCACTGGGGATGTGG + Intronic
1061246779 9:129404727-129404749 CACTGGGTCCTGAGGGCAGGTGG - Intergenic
1061967128 9:134021484-134021506 CAGTAGGTCCACCCGGGAGGTGG - Intergenic
1061995366 9:134180392-134180414 CACAGGATCCCCAGGGGAGGGGG - Intergenic
1062129765 9:134885986-134886008 CTCTTGGCCCACAGGGGATTGGG + Intronic
1062133386 9:134912379-134912401 CTCTTGGCCCACAGGGGATTGGG - Intronic
1203791735 EBV:155304-155326 CCTCTGGTCGACAGGGGAGGAGG - Intergenic
1185526486 X:784415-784437 CAATTGAACCTCAGGGGAGGAGG - Intergenic
1186701556 X:12095680-12095702 TCCTTGGACAACAGGGGAGGTGG - Intergenic
1192559036 X:72113350-72113372 CATTTGGTCCACAGGGGAGTCGG - Intergenic
1193241502 X:79175575-79175597 AACTTGGTCCACAGTGAAGATGG - Intergenic
1199602928 X:149553625-149553647 CTCTTAGTCCAGAGGGGAGATGG - Intergenic
1199647461 X:149925850-149925872 CTCTTAGTCCAGAGGGGAGATGG + Intergenic
1200164914 X:154029463-154029485 GACTTAGTGGACAGGGGAGGGGG - Intronic
1201405489 Y:13645619-13645641 TACTGTGTCCACAGAGGAGGAGG + Intergenic
1201462300 Y:14239819-14239841 TACTCTGTCCCCAGGGGAGGGGG - Intergenic