ID: 1005883258

View in Genome Browser
Species Human (GRCh38)
Location 6:30075633-30075655
Sequence CCTTCGAGCGCGCAGATGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005883247_1005883258 4 Left 1005883247 6:30075606-30075628 CCGCCCCTTCCGCGACCACCGTG 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 34
1005883245_1005883258 28 Left 1005883245 6:30075582-30075604 CCATGGAAAGCCAGGATCTGGAC 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 34
1005883250_1005883258 -1 Left 1005883250 6:30075611-30075633 CCTTCCGCGACCACCGTGACCGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 34
1005883246_1005883258 18 Left 1005883246 6:30075592-30075614 CCAGGATCTGGACGCCGCCCCTT 0: 1
1: 0
2: 2
3: 6
4: 62
Right 1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 34
1005883248_1005883258 1 Left 1005883248 6:30075609-30075631 CCCCTTCCGCGACCACCGTGACC 0: 1
1: 0
2: 0
3: 8
4: 54
Right 1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 34
1005883251_1005883258 -5 Left 1005883251 6:30075615-30075637 CCGCGACCACCGTGACCGCCTTC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 34
1005883249_1005883258 0 Left 1005883249 6:30075610-30075632 CCCTTCCGCGACCACCGTGACCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005883258 Original CRISPR CCTTCGAGCGCGCAGATGGC GGG Exonic
902583309 1:17422994-17423016 CATTCCAGCGGGCAGAGGGCCGG - Intronic
915913826 1:159929778-159929800 CCTTCGCGCACGCAGCTGCCGGG - Exonic
920331094 1:205208981-205209003 CCTGGGAGGGTGCAGATGGCAGG - Intronic
1063523938 10:6766419-6766441 CATTCGAGAGAGCAGAAGGCAGG - Intergenic
1065807601 10:29409523-29409545 CCTTGGAGCGCGCACATGCGCGG + Intergenic
1071730606 10:88244527-88244549 CTTTAGAGTGGGCAGATGGCAGG + Intergenic
1079247093 11:18760685-18760707 CCTTCCTGCGGGCAGCTGGCTGG - Intronic
1081858781 11:46320336-46320358 CCATGGAGCCCCCAGATGGCTGG + Exonic
1089157011 11:116410244-116410266 ACTTCGAGAGGGCAGATGGGTGG + Intergenic
1089346717 11:117796029-117796051 CCCCCGGGCGCGCAGATGGCGGG - Intronic
1090109623 11:123892303-123892325 CCTTAGAGAGAGCAGATGGCTGG + Intergenic
1093412430 12:18882741-18882763 CAATCTAGCGTGCAGATGGCAGG - Intergenic
1103975652 12:124701031-124701053 CCTTCGGATGTGCAGATGGCCGG - Intergenic
1104471691 12:129034664-129034686 CCTTCCAGCTCTCAGATGCCTGG + Intergenic
1105418506 13:20232655-20232677 CCCTCGGGAGCGCAGAGGGCGGG + Intergenic
1114252284 14:20971574-20971596 CCTTCCAGCCAGCAGAGGGCAGG - Intergenic
1121101635 14:91253770-91253792 CCAGCGCGCACGCAGATGGCGGG + Exonic
1132588258 16:715461-715483 CCTCGGAGCGCGCAGAGCGCTGG + Intronic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1133322590 16:4923480-4923502 CCTTCCAGGTCGCTGATGGCTGG - Intronic
1151362837 17:73598815-73598837 CCTTCGAGCTCACAGGTGCCAGG - Intronic
1153626777 18:7028832-7028854 CCTTCGAGCCCGTAGCTGCCCGG - Intronic
1165329653 19:35134480-35134502 CCTTCGGGCATGCAGAAGGCTGG + Intronic
929601399 2:43206884-43206906 CCTGGGAGCGCACAGATGGGAGG - Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1184374299 22:44102070-44102092 CTTTCTAGCTTGCAGATGGCAGG - Intronic
956004141 3:64761026-64761048 CCTTCCAGCTCCCAGATTGCTGG - Intergenic
991198059 5:63959427-63959449 GCTGCGAGAGCACAGATGGCTGG + Intergenic
1000075010 5:157776820-157776842 CCTTCGAGCCCTCAGATGAGAGG + Intergenic
1003092893 6:3118877-3118899 CCCTCGAGCGCGCCGATGCTGGG - Intronic
1003490940 6:6620967-6620989 CCTTCGAGGGCCCACATGCCCGG + Intronic
1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG + Exonic
1016234397 6:141845358-141845380 CCTTTGAAAGCGCAGAGGGCAGG - Intergenic
1034478748 7:151303780-151303802 CCTGGGAGAGCGCAGTTGGCTGG - Intergenic
1047406908 8:124593143-124593165 ACTTGGAGAGCGCAGAAGGCGGG - Intronic
1049709809 8:144058404-144058426 CCTGCGAGCGGGCAGCAGGCGGG + Exonic
1056331808 9:85527453-85527475 CATTGGAGAGAGCAGATGGCTGG - Intergenic
1057883020 9:98807659-98807681 CCTTGGGGCGCGCAGATCGCTGG + Intergenic