ID: 1005883799

View in Genome Browser
Species Human (GRCh38)
Location 6:30079603-30079625
Sequence GTCACTGCACCTTTAAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005883799_1005883807 17 Left 1005883799 6:30079603-30079625 CCAAATTTTAAAGGTGCAGTGAC No data
Right 1005883807 6:30079643-30079665 GGATTCTGTTGACAGATTGAAGG No data
1005883799_1005883806 -4 Left 1005883799 6:30079603-30079625 CCAAATTTTAAAGGTGCAGTGAC No data
Right 1005883806 6:30079622-30079644 TGACGGGGGAAGAGTGAGGGAGG No data
1005883799_1005883805 -7 Left 1005883799 6:30079603-30079625 CCAAATTTTAAAGGTGCAGTGAC No data
Right 1005883805 6:30079619-30079641 CAGTGACGGGGGAAGAGTGAGGG No data
1005883799_1005883804 -8 Left 1005883799 6:30079603-30079625 CCAAATTTTAAAGGTGCAGTGAC No data
Right 1005883804 6:30079618-30079640 GCAGTGACGGGGGAAGAGTGAGG No data
1005883799_1005883809 26 Left 1005883799 6:30079603-30079625 CCAAATTTTAAAGGTGCAGTGAC No data
Right 1005883809 6:30079652-30079674 TGACAGATTGAAGGACAAGTGGG No data
1005883799_1005883808 25 Left 1005883799 6:30079603-30079625 CCAAATTTTAAAGGTGCAGTGAC No data
Right 1005883808 6:30079651-30079673 TTGACAGATTGAAGGACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005883799 Original CRISPR GTCACTGCACCTTTAAAATT TGG (reversed) Intergenic
No off target data available for this crispr