ID: 1005884977

View in Genome Browser
Species Human (GRCh38)
Location 6:30090755-30090777
Sequence GCAAAGCTGTTACCTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005884973_1005884977 5 Left 1005884973 6:30090727-30090749 CCCAAATTGTTCTTGCCTCTAGG No data
Right 1005884977 6:30090755-30090777 GCAAAGCTGTTACCTGTGCCTGG No data
1005884976_1005884977 -10 Left 1005884976 6:30090742-30090764 CCTCTAGGTTGATGCAAAGCTGT No data
Right 1005884977 6:30090755-30090777 GCAAAGCTGTTACCTGTGCCTGG No data
1005884975_1005884977 4 Left 1005884975 6:30090728-30090750 CCAAATTGTTCTTGCCTCTAGGT No data
Right 1005884977 6:30090755-30090777 GCAAAGCTGTTACCTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005884977 Original CRISPR GCAAAGCTGTTACCTGTGCC TGG Intergenic
No off target data available for this crispr