ID: 1005886787

View in Genome Browser
Species Human (GRCh38)
Location 6:30103137-30103159
Sequence GAGAGGAGCAACGCCAGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005886787_1005886795 11 Left 1005886787 6:30103137-30103159 CCCAGGCTGGCGTTGCTCCTCTC 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1005886795 6:30103171-30103193 CCTGGCTGAACTGGTGCCTTCGG 0: 1
1: 0
2: 0
3: 14
4: 200
1005886787_1005886793 2 Left 1005886787 6:30103137-30103159 CCCAGGCTGGCGTTGCTCCTCTC 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1005886793 6:30103162-30103184 GATTTCACTCCTGGCTGAACTGG 0: 1
1: 0
2: 1
3: 13
4: 114
1005886787_1005886790 -7 Left 1005886787 6:30103137-30103159 CCCAGGCTGGCGTTGCTCCTCTC 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1005886790 6:30103153-30103175 TCCTCTCCGGATTTCACTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005886787 Original CRISPR GAGAGGAGCAACGCCAGCCT GGG (reversed) Exonic
901002166 1:6154311-6154333 GAGTGGAGCCGCTCCAGCCTGGG - Intronic
901145053 1:7059132-7059154 GAGAGGAGCAGCAGCAGCCTGGG - Intronic
901727921 1:11256897-11256919 GGGAGGAGCACAGCCAGGCTTGG - Intronic
902552986 1:17230294-17230316 TAGAGAAGCCACGGCAGCCTGGG + Intronic
902796688 1:18805011-18805033 GAGAGGAGAGAAGCCAGCCCTGG - Intergenic
903035150 1:20487944-20487966 GAGAGGAACAAGGTCAGTCTGGG - Intergenic
904341595 1:29838401-29838423 GAGAGGAGCAAGGACAGCTGGGG - Intergenic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
905690729 1:39940831-39940853 AAGCTGCGCAACGCCAGCCTTGG - Intergenic
905934156 1:41810512-41810534 AAGAGGAGAAGCACCAGCCTTGG + Intronic
906625396 1:47320911-47320933 CAGAAGATCAAGGCCAGCCTGGG + Intergenic
907520250 1:55019307-55019329 GAGATGAGAAACCCCAGGCTTGG - Intergenic
907714834 1:56917001-56917023 GAGGGGAGCACCGCCCTCCTGGG - Intronic
913489814 1:119368423-119368445 GAGAAGAGCAAGCACAGCCTGGG - Intergenic
915130658 1:153693405-153693427 GAGAGGAGGCAGGTCAGCCTCGG - Exonic
915895949 1:159810982-159811004 CAGAGGAGAAAGGGCAGCCTGGG - Intronic
916315509 1:163444015-163444037 AAGAGGAGCCAAGCCAGCCTGGG - Intergenic
919878479 1:201887611-201887633 AAGAGGAGCTACCCCATCCTGGG - Intergenic
920402249 1:205683258-205683280 GTGAGGAGCAAGGCCATCCTTGG + Intergenic
920705765 1:208249399-208249421 ATGAGGACCAACTCCAGCCTGGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
923142165 1:231169741-231169763 GATAGGAGAGAAGCCAGCCTAGG - Intronic
923663911 1:235982106-235982128 TGGAGGAGGAACCCCAGCCTGGG + Intronic
1062844462 10:693132-693154 GAGAGGAGCAGCCCCTTCCTCGG + Intergenic
1063205138 10:3823831-3823853 AAGAGGAGCAACGCCATGCCTGG - Intergenic
1063859866 10:10295522-10295544 ACGAGGAGGAAAGCCAGCCTTGG - Intergenic
1064208981 10:13347830-13347852 GAGAGGGGCAGCGCCGGGCTTGG - Intronic
1070278420 10:75030180-75030202 GAGACGAGCAACGCCAACATTGG + Exonic
1071525574 10:86356125-86356147 CAGAGGTGCAACCCCAGCCTAGG + Intronic
1071562443 10:86654880-86654902 CAGAGCAGCATCTCCAGCCTGGG + Exonic
1073043624 10:100623554-100623576 GGAAGGAGCAAGGCCAGCCATGG + Intergenic
1073059748 10:100726314-100726336 GAGAGGGGCAAGGCCTGACTGGG + Intergenic
1073070905 10:100792683-100792705 GAAAGGACCAACGCCATCCTTGG - Intronic
1076803981 10:132846094-132846116 GACAGGACCACCACCAGCCTGGG - Exonic
1076833166 10:133007109-133007131 GTGAGGAGCCACGCCTGCCGTGG + Intergenic
1077177444 11:1197173-1197195 GGGAAGAGCACAGCCAGCCTCGG - Intronic
1077841704 11:5982636-5982658 TAGAGGAGCATGGCAAGCCTTGG + Intergenic
1078424615 11:11238997-11239019 GAAAGCAGCAACTCCAGCGTGGG + Intergenic
1078480184 11:11668715-11668737 GATTGGAGCAAAGTCAGCCTGGG - Intergenic
1082219807 11:49620909-49620931 GACTGGAGCAACTCCAGCTTTGG + Intergenic
1086130788 11:83400360-83400382 GAGATGAGCAAGGCCAGGCATGG + Intergenic
1086629828 11:89003877-89003899 GACTGGAGCAACTCCAGCTTTGG - Intronic
1087046765 11:93849834-93849856 GCGAGGACCACCTCCAGCCTGGG + Intronic
1088708440 11:112484491-112484513 GAGAGCAGCAAAGCTAACCTGGG + Intergenic
1089131964 11:116219332-116219354 GAGAGGAGCAACCACCGTCTGGG - Intergenic
1089596121 11:119581590-119581612 TAGGAGAGCAAGGCCAGCCTGGG + Intergenic
1090668756 11:128931411-128931433 CAGAGGTTCAAGGCCAGCCTGGG + Intergenic
1092057891 12:5522599-5522621 GTGTGGAGCAACCACAGCCTGGG - Intergenic
1093641170 12:21528032-21528054 GGGAGCCGCAGCGCCAGCCTGGG - Intronic
1095919672 12:47516768-47516790 GAGATGGGCTACGACAGCCTTGG + Intergenic
1095965244 12:47863140-47863162 GTGAAGAGCAGCACCAGCCTGGG - Intronic
1095971454 12:47904719-47904741 GAGGGGAGCAGCGACATCCTCGG - Exonic
1099230276 12:80015364-80015386 GAGATGAGCAATGACATCCTAGG + Intergenic
1101816839 12:108152000-108152022 GAGAGCAGCGACGCCGCCCTTGG - Intronic
1102419275 12:112791294-112791316 GAGAGGAGCAATGCAGGACTGGG + Intronic
1102540890 12:113618282-113618304 CAGAAGATCAAGGCCAGCCTGGG + Intergenic
1103814834 12:123646468-123646490 CAGGAGAGCAAGGCCAGCCTGGG - Intronic
1104803895 12:131572620-131572642 TGCAGGAGCAGCGCCAGCCTGGG + Intergenic
1104862022 12:131928967-131928989 GAGAGGAGCGGGGCCAGCGTGGG + Intergenic
1106506984 13:30379190-30379212 GAGAGGAGCAAAGGCAGGGTAGG + Intergenic
1106846549 13:33743568-33743590 GAGAGGAGCCATTTCAGCCTGGG - Intergenic
1107528187 13:41255251-41255273 GAGAATAGCTACTCCAGCCTGGG - Intronic
1107933620 13:45326641-45326663 GAGTGGATCAAGACCAGCCTGGG + Intergenic
1108263279 13:48679257-48679279 GGGAGGGGCCACACCAGCCTTGG - Intronic
1108416727 13:50205172-50205194 CAGGGGTTCAACGCCAGCCTGGG - Intronic
1113280017 13:108778836-108778858 GAGAGGTTCTATGCCAGCCTTGG - Intronic
1113455487 13:110445928-110445950 GAGGGGAGTAAGGCCAGCCAGGG - Intronic
1114269953 14:21094472-21094494 GAGAGGAGGAAAGCCTGCCTCGG - Intronic
1116282728 14:42929097-42929119 TAGAGGAGCATGGCAAGCCTTGG + Intergenic
1119287993 14:73471608-73471630 GGGAGGATCAAGACCAGCCTAGG - Intergenic
1121459500 14:94063700-94063722 GGGAGGATCAAGACCAGCCTGGG + Intronic
1122116324 14:99529142-99529164 GGGAGGAGCAGTGCCAGCCATGG - Intronic
1122262662 14:100531975-100531997 GGGAGCAGGAACCCCAGCCTGGG - Intergenic
1122707560 14:103630146-103630168 AGTTGGAGCAACGCCAGCCTAGG - Intronic
1122755370 14:103974479-103974501 CAGAGGAACAACCCCAGACTGGG - Intronic
1122860024 14:104578350-104578372 GGGAGGAGCAGCTCCAGCCCTGG + Intronic
1125367389 15:38932597-38932619 CAGAGGAGCATGGCAAGCCTTGG + Intergenic
1125718155 15:41831259-41831281 GAGAGGAGCTACTCTAGCCAGGG + Intronic
1128305774 15:66598112-66598134 GAGAGGAAGAGCGGCAGCCTTGG - Intronic
1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG + Intergenic
1129803855 15:78438180-78438202 GAGAGCAGCAGAGCCAGCCCCGG - Exonic
1130536283 15:84787201-84787223 GAAAGGTGCCATGCCAGCCTGGG - Intronic
1130882425 15:88066743-88066765 GACAGGAACAGTGCCAGCCTGGG + Intronic
1131937034 15:97517879-97517901 GTGAATAGCAACTCCAGCCTGGG + Intergenic
1132402664 15:101522991-101523013 GAGAGGAGCAAGGCAGGGCTGGG + Intronic
1132769076 16:1551057-1551079 GCGAGGAGGAACAGCAGCCTTGG - Intronic
1133124939 16:3640759-3640781 GAGTGGTACAGCGCCAGCCTGGG + Intronic
1135783623 16:25328171-25328193 GAGAGGTTCAAGACCAGCCTGGG - Intergenic
1136017815 16:27416190-27416212 GTGAGCTGCAACTCCAGCCTGGG - Intronic
1136753592 16:32664894-32664916 GAAAGGATCACCTCCAGCCTGGG - Intergenic
1136814521 16:33205471-33205493 GAAAGGATCACCTCCAGCCTGGG + Intronic
1136820997 16:33315551-33315573 GAAAGGATCACCTCCAGCCTGGG + Intergenic
1136827560 16:33372090-33372112 GAAAGGATCACCTCCAGCCTGGG + Intergenic
1136832626 16:33470861-33470883 GAAAGGATCACCTCCAGCCTGGG + Intergenic
1141422079 16:83923980-83924002 GAGAGAAGCCACCCCAGCCTGGG - Exonic
1141550637 16:84804527-84804549 CAGTGGAGCAGCCCCAGCCTGGG + Intergenic
1202993097 16_KI270728v1_random:28445-28467 GAAAGGATCACCTCCAGCCTGGG + Intergenic
1142625121 17:1186986-1187008 GCGAGGAGCACGGCCAGCTTCGG - Intronic
1151916584 17:77122775-77122797 CAGAGCAGCAACGCCACCCAAGG + Intronic
1152067346 17:78119029-78119051 GAGAAGAGCACCCCCAGCCTGGG + Exonic
1153603331 18:6805031-6805053 CAGAGGTTCAAGGCCAGCCTGGG - Intronic
1154109984 18:11559551-11559573 CAGAGGACAAACACCAGCCTGGG - Intergenic
1156358702 18:36364838-36364860 GAGAGGAGCAAGGCAAGGCTGGG + Intronic
1157689434 18:49668926-49668948 GAGATGAACAAAGCCAGCATGGG - Intergenic
1160557997 18:79738454-79738476 GGTAGGAGCAGCGCCAGCCTCGG + Intronic
1161226025 19:3146332-3146354 GAGAGGGGGAAGGGCAGCCTTGG + Intronic
1162744600 19:12791494-12791516 GAGAGCGGCCAGGCCAGCCTCGG + Exonic
1163149613 19:15403221-15403243 GAGAGGAACAAGCCCAGACTGGG - Intronic
1164643605 19:29843406-29843428 GAGAGGAGGGAGGCCGGCCTGGG + Intergenic
1166909159 19:46138871-46138893 TAGAGGAGCAAGGTGAGCCTTGG + Intergenic
1167466044 19:49651596-49651618 AAGAGGGACAGCGCCAGCCTGGG - Exonic
1168240176 19:55084945-55084967 GAGAGTGGCATCGCCAGCCCGGG - Intronic
925293878 2:2765464-2765486 GAGAGGAGCGGAGGCAGCCTGGG - Intergenic
927184583 2:20473199-20473221 GAGAGCACCATCTCCAGCCTTGG + Intergenic
927638788 2:24834113-24834135 GAGAGGGGCCAGGTCAGCCTTGG + Intronic
929941314 2:46336095-46336117 GAGAGGAGCAAGGCTGGGCTGGG + Intronic
931705573 2:64943910-64943932 GACACGAGCAAGGCCAGTCTGGG - Intergenic
931737161 2:65206401-65206423 GGGAGGATCAAGACCAGCCTGGG + Intergenic
932175978 2:69602686-69602708 CAAAGGAGGAAGGCCAGCCTTGG - Intronic
932586897 2:73036148-73036170 CAGATGAGCAGGGCCAGCCTGGG + Intronic
933966815 2:87436834-87436856 GAGAGGAGCAAGGCTGCCCTTGG - Intergenic
933967534 2:87442322-87442344 GAGAGGAGCAAGGCTGCCCTTGG - Intergenic
935243380 2:101197280-101197302 GAGAGGAGAAGAACCAGCCTTGG + Intronic
935350461 2:102147979-102148001 GATAGGAGCATTGCCAGGCTTGG + Intronic
936326261 2:111508174-111508196 GAGAGGAGCAAGGCTGCCCTTGG + Intergenic
936326980 2:111513652-111513674 GAGAGGAGCAAGGCTGCCCTTGG + Intergenic
936692815 2:114912934-114912956 TAGAGGAGCATGGCAAGCCTTGG - Intronic
938111948 2:128573761-128573783 GAGAGGAGCTCAGCCAGCCTTGG + Intergenic
938114484 2:128594057-128594079 GGCAGGAGCATCGCCAGCCCTGG - Intergenic
942241890 2:173970499-173970521 GAGAGAAGCAAGGGCAGGCTTGG + Intergenic
945086225 2:206135234-206135256 GTCAGGAGCAAGACCAGCCTGGG - Intronic
946865040 2:224035180-224035202 GAGACGATCATCGACAGCCTGGG - Intronic
948133605 2:235619736-235619758 GAGATCAGCAACACCAGCTTCGG + Intronic
948786564 2:240355882-240355904 GAGACCAGCAACGCCTGGCTGGG + Intergenic
1168900486 20:1359735-1359757 GAGAGCAGAAACGGCAGCCGTGG - Intronic
1170761867 20:19258152-19258174 GATAGAAGCACCGCCATCCTGGG + Intronic
1172838404 20:37887533-37887555 GAGAGCAGCAACTTCAGCCTGGG - Intergenic
1173307246 20:41862347-41862369 TAGAGGGGCCACGCCAGGCTGGG + Intergenic
1173620097 20:44430026-44430048 GAGAGGAGAAGCACCAGGCTAGG - Exonic
1174185585 20:48703722-48703744 GAGAGGAAGTCCGCCAGCCTGGG + Intronic
1177183232 21:17765994-17766016 GAGAGCAGCAAGGCCCCCCTAGG + Intergenic
1178468251 21:32868942-32868964 GCGAGGGGCCACGCCACCCTGGG - Intergenic
1179481305 21:41680387-41680409 GAGATGAGCAATGGCAGCTTTGG - Intergenic
1180619358 22:17149805-17149827 GAGAGGCTCAACACCATCCTCGG + Intronic
1181408618 22:22702778-22702800 GCGAAGAGGAAGGCCAGCCTGGG + Intergenic
1181784776 22:25219149-25219171 AAGAGGACCTACGCCAGCCCAGG - Intergenic
1181797441 22:25320336-25320358 GAGAGGATCAAAGCCACCCACGG + Intergenic
1182106774 22:27695331-27695353 GAGAAGTTCAACACCAGCCTGGG + Intergenic
1184496618 22:44846031-44846053 GAGAGGAGCCAGCCCTGCCTTGG - Intronic
1184806614 22:46798750-46798772 CAGAGGTGCAACGCCTGGCTTGG + Intronic
1184995141 22:48199842-48199864 GAGAGGTGAGAAGCCAGCCTGGG - Intergenic
950065130 3:10106125-10106147 CAGAGGAGCTACACCAGGCTGGG + Intronic
950903376 3:16516237-16516259 AAGAGGAGTTAAGCCAGCCTAGG + Intergenic
952990647 3:38828253-38828275 GAGAGGAGCAGCGCCAGAATGGG - Intergenic
953096395 3:39780794-39780816 GAGAGGAAGAAAGTCAGCCTTGG - Intergenic
953608046 3:44424621-44424643 GAGAGGAGAAAAGCCTGCTTGGG - Intergenic
953677049 3:45010958-45010980 GAGAGCAGCAAAGCCTGCCCTGG - Intronic
956378852 3:68644827-68644849 TAGAGGAGCATGGCAAGCCTTGG + Intergenic
958077973 3:88708992-88709014 GAGAGGTGCAAATACAGCCTTGG + Intergenic
964601795 3:158509573-158509595 CAGAGGTTCAAGGCCAGCCTGGG + Intronic
967160844 3:186736556-186736578 GACAGGAGCATCAACAGCCTTGG - Intronic
968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG + Intronic
968565285 4:1309435-1309457 CAGAGGAGCCAGGCCAGCCCCGG - Intronic
969096388 4:4735822-4735844 CAGAGGAGGGACGCCAGCCCAGG + Intergenic
969597934 4:8159381-8159403 GCGAGGAGCGACGGGAGCCTGGG - Intergenic
969837005 4:9850384-9850406 TAGAGGAGCATGGCAAGCCTTGG - Intronic
971729682 4:30361347-30361369 TAGAGGAGCAAGGCCAGCCTTGG + Intergenic
972689209 4:41380353-41380375 GAGGAGATCAAGGCCAGCCTAGG - Intronic
973034666 4:45390964-45390986 TAGAGGAGCATGGCAAGCCTTGG + Intergenic
973840663 4:54857170-54857192 GAGAGAAGCAACAGCAGCATGGG + Intergenic
975105543 4:70564631-70564653 GAGCCGAGACACGCCAGCCTGGG - Intergenic
975299914 4:72777824-72777846 AAGAGGAACAACGTAAGCCTAGG - Intergenic
975909172 4:79247981-79248003 TAGGGGAGCAAGGCAAGCCTTGG - Intronic
977294312 4:95193897-95193919 GAAAGGAGCAAAGCCAGGCCGGG - Intronic
980532264 4:134070942-134070964 TAGAGGAGCATGGCGAGCCTTGG + Intergenic
980843849 4:138300385-138300407 CAGAAGAGCAAGGCTAGCCTGGG - Intergenic
983934910 4:173494960-173494982 GACAGGAGAAAGGCCATCCTAGG + Intergenic
985788325 5:1911517-1911539 GAAAGGAGCAAAGCCAGCTGGGG - Intergenic
989216220 5:38907459-38907481 TAGAGGAGCAAGGCAAGGCTTGG - Intronic
989733850 5:44679306-44679328 TAGAGGAGCATGGCAAGCCTTGG - Intergenic
995932014 5:117456815-117456837 TAGAGGTGCATCGCCAGCCCAGG + Intergenic
997187888 5:131900587-131900609 TAGAGGAGGAAGGCAAGCCTTGG - Intronic
997622588 5:135308369-135308391 GGGAGTAGCAAAGCCAGGCTAGG - Intronic
997646359 5:135484735-135484757 GAGAGGCGTAAGGCCAGCCACGG - Intergenic
997734772 5:136205181-136205203 AAGTGGAGCAAAGCCAACCTGGG + Intergenic
1001122420 5:168991578-168991600 GAGTGGGGAAATGCCAGCCTGGG + Intronic
1001634223 5:173198250-173198272 GAGAAGAGCAAGCCCAGGCTGGG - Intergenic
1002471469 5:179438460-179438482 AGGAGGAGCAAAGCCTGCCTGGG + Intergenic
1003213698 6:4090099-4090121 GAGGGAAGCAGCTCCAGCCTTGG - Intronic
1003284899 6:4725709-4725731 GAGGGAAGCAGCTCCAGCCTTGG + Intronic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1006375582 6:33670022-33670044 GAGATGAGAAGAGCCAGCCTTGG - Intronic
1006628841 6:35416826-35416848 GAGTGGAGCAACGCCAGGTAAGG - Intronic
1007090112 6:39178856-39178878 GACAGGAGCCAGGCCAGCCTTGG - Intergenic
1007217338 6:40250646-40250668 GAGAGGAACATTGCCAGCCATGG + Intergenic
1007740508 6:44006718-44006740 GAGAGGAGCAAGTACAGCCCAGG + Intergenic
1008004155 6:46392220-46392242 TAGAGGAGGAACGCCAGCAAGGG + Intronic
1010361526 6:75000693-75000715 GAGGAGATCAAGGCCAGCCTGGG + Intergenic
1010682118 6:78809286-78809308 TAGAGGAGCAAGTCAAGCCTAGG + Intergenic
1011705395 6:89996080-89996102 GATAGGAGGAACACCAGCATAGG - Intronic
1011871198 6:91895395-91895417 GACAGGAGTAAGGACAGCCTCGG + Intergenic
1013311990 6:108903314-108903336 GCCAGGATCAAGGCCAGCCTGGG - Intronic
1017006915 6:150034387-150034409 CCCAGGAGCAAGGCCAGCCTGGG + Intergenic
1017192516 6:151669239-151669261 GAAACCAGCAACCCCAGCCTGGG - Intronic
1019104192 6:169655661-169655683 GGCAGGGGCATCGCCAGCCTCGG - Intronic
1020051892 7:5087111-5087133 CAGAGGTTCAAGGCCAGCCTGGG + Intergenic
1021106308 7:16643950-16643972 GAGAGCTGCAACTCCAGCCTGGG + Intronic
1022121698 7:27314634-27314656 GTGAGGAGCTGCGCCCGCCTGGG - Intergenic
1023096687 7:36668627-36668649 GAGAGGTGCACCGCCACCCCCGG + Intronic
1024248064 7:47485392-47485414 GAGAGGGCCAGCGCCAGCCACGG + Intronic
1024489173 7:49957826-49957848 GAGATAAGCAATACCAGCCTGGG + Intronic
1024861845 7:53853425-53853447 GAGAGGGGCAACCCCAACCTTGG - Intergenic
1025607836 7:63052194-63052216 CAGAGGATCAAAGTCAGCCTGGG + Intergenic
1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG + Intronic
1029341049 7:99944972-99944994 AAAGGGAGCAAAGCCAGCCTTGG + Intergenic
1029563468 7:101319544-101319566 GAGAGGATCAAAGTCAGCCTGGG + Intronic
1029642300 7:101828902-101828924 GAGAGGAGCCACCCCAGGCAGGG + Intronic
1030065473 7:105655831-105655853 GAGAGGAGCCCCGCCTACCTGGG + Intronic
1031613164 7:123850781-123850803 GGCAGGAGGAACTCCAGCCTAGG - Intronic
1033878780 7:145856099-145856121 CAAAGAAGCAACCCCAGCCTGGG + Intergenic
1034531389 7:151698164-151698186 GGGAGGAGCGCCGCCAGCTTGGG + Intronic
1035098997 7:156381284-156381306 GAGAGCAGCAACGCCTGCGGTGG + Intergenic
1036189975 8:6661506-6661528 GAGGGGAGGAACGCCATCCTGGG + Intergenic
1036708466 8:11061940-11061962 GGGAGGAGCAGGGCCAGCCGAGG - Intronic
1037568657 8:20140155-20140177 CAGGAGATCAACGCCAGCCTGGG + Intergenic
1037965345 8:23129673-23129695 AAGAGGAGCACCGCCAACCCTGG - Intergenic
1038348842 8:26757982-26758004 AAGATGACAAACGCCAGCCTTGG + Intronic
1039444403 8:37619484-37619506 GAGAAGACCAAAGCCAGCCTTGG + Intergenic
1042216474 8:66433295-66433317 GAGAAGAGCAACACCAGCGATGG + Intronic
1044548043 8:93481429-93481451 GAGAGGAGGAAGGCCAGACTGGG + Intergenic
1044795981 8:95898000-95898022 TATAGGAGCAAAGGCAGCCTGGG + Intergenic
1048646567 8:136427695-136427717 GAGAAGAGAAACGCCATGCTGGG + Intergenic
1048941467 8:139404168-139404190 GAGAGCAGCAACTCCAGGTTGGG + Intergenic
1049442271 8:142614832-142614854 GAGAGGAGGAAGGCCACCTTGGG - Intergenic
1049443026 8:142617791-142617813 GAGATCAGCAGGGCCAGCCTGGG - Intergenic
1049697450 8:143990934-143990956 GAGGGGACGACCGCCAGCCTCGG - Intronic
1053474938 9:38375850-38375872 GAGAGAATCAGCCCCAGCCTGGG - Intergenic
1055426985 9:76206480-76206502 GAGAGTTGCACCGGCAGCCTGGG - Intronic
1057310587 9:93940619-93940641 GAGAGGAGCAAGGGTAGGCTGGG - Intergenic
1058157184 9:101528958-101528980 GAGAGGAGCAACACAAACCAGGG - Intronic
1060966271 9:127714020-127714042 CAGAGCTGCCACGCCAGCCTTGG - Exonic
1061926451 9:133808296-133808318 GGCCGGAGCAAGGCCAGCCTGGG + Intronic
1061960604 9:133987089-133987111 GAGAGGAGGAAGCCCAGCCGTGG + Intronic
1062162090 9:135086433-135086455 GAGAGGAACAACGCCTTCCTGGG - Intronic
1062674427 9:137732119-137732141 CAGTGGAGCCAGGCCAGCCTGGG - Intronic
1187694328 X:21903386-21903408 GAGGGGTTCAAGGCCAGCCTGGG - Intergenic
1187854060 X:23619671-23619693 GAGAGGAGGAAAGTGAGCCTAGG - Intergenic
1189007329 X:37009558-37009580 GAGAGGAGGTACGCGAGTCTTGG - Exonic
1190973746 X:55379288-55379310 TAGAGGAGCATGGCAAGCCTTGG - Intergenic
1192193981 X:69016533-69016555 GAGAGCAGCCAGGCCAGGCTGGG + Intergenic
1192244156 X:69359241-69359263 GAAAGGTCCAAAGCCAGCCTGGG - Intergenic
1195517559 X:105794745-105794767 GAGGGGAGCACCTCCAGTCTAGG + Intergenic
1196182958 X:112715082-112715104 GAGAGGATCCTCTCCAGCCTTGG + Intergenic
1197296313 X:124723402-124723424 TAGAGGAGAAAGGCCAGCGTAGG - Intronic
1202019203 Y:20447879-20447901 GAGAAGAGCAGCACCAGTCTCGG + Intergenic