ID: 1005886908

View in Genome Browser
Species Human (GRCh38)
Location 6:30103868-30103890
Sequence TGAGCTCTACATACAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 309}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005886906_1005886908 -9 Left 1005886906 6:30103854-30103876 CCAGACAGCACAGCTGAGCTCTA 0: 1
1: 0
2: 1
3: 23
4: 157
Right 1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG 0: 1
1: 0
2: 1
3: 39
4: 309
1005886905_1005886908 -3 Left 1005886905 6:30103848-30103870 CCATTGCCAGACAGCACAGCTGA 0: 1
1: 0
2: 1
3: 40
4: 288
Right 1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG 0: 1
1: 0
2: 1
3: 39
4: 309
1005886904_1005886908 0 Left 1005886904 6:30103845-30103867 CCTCCATTGCCAGACAGCACAGC 0: 1
1: 0
2: 3
3: 21
4: 331
Right 1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG 0: 1
1: 0
2: 1
3: 39
4: 309
1005886903_1005886908 13 Left 1005886903 6:30103832-30103854 CCTCGGCAGCAATCCTCCATTGC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG 0: 1
1: 0
2: 1
3: 39
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005886908 Original CRISPR TGAGCTCTACATACAGCAGG AGG Intronic
903066139 1:20700795-20700817 TGAGAGTTACATACAGCAGGTGG - Intronic
903686415 1:25135462-25135484 GGAGCTCCACATACATGAGGGGG + Intergenic
906036390 1:42752638-42752660 TGATGCCTTCATACAGCAGGGGG + Exonic
906536140 1:46551986-46552008 TGAGATAGACACACAGCAGGAGG + Intergenic
906734875 1:48115777-48115799 AGGGCTCTACAATCAGCAGGTGG - Intergenic
906826968 1:48992511-48992533 AGAACTCTACAATCAGCAGGCGG + Intronic
907562415 1:55403068-55403090 TTAGCTGGAGATACAGCAGGCGG + Intergenic
908397503 1:63739972-63739994 AGGGCTCTACAATCAGCAGGTGG + Intergenic
908598910 1:65718333-65718355 GGGGCTCTACAGTCAGCAGGTGG + Intergenic
909084416 1:71154688-71154710 AGGGCTCTACAATCAGCAGGTGG + Intergenic
909271393 1:73627616-73627638 GGTGCTCTACAATCAGCAGGTGG - Intergenic
909316340 1:74223985-74224007 TGGGCTCTATAATCAGCAGGAGG - Intronic
909420724 1:75462001-75462023 AGGGCTCTACAGTCAGCAGGTGG - Intronic
910289866 1:85589293-85589315 AGGGCTCTACAATCAGCAGGTGG - Intergenic
912135933 1:106660069-106660091 GGGGCTCTACAGTCAGCAGGTGG - Intergenic
912873034 1:113327600-113327622 GGGGCTCTACAATCAGCAGGTGG + Intergenic
912953722 1:114137917-114137939 TGAGCTCTACAAGCAGAAGTCGG - Exonic
919336712 1:196244815-196244837 AGAGCTCTACAAACAGAAGGTGG - Intronic
920269424 1:204752123-204752145 TGCCCGCTCCATACAGCAGGAGG - Intergenic
921456838 1:215380998-215381020 TGGGCACTACAATCAGCAGGTGG - Intergenic
922320407 1:224481782-224481804 AGGGCTCTACACTCAGCAGGTGG + Intronic
924490729 1:244535287-244535309 AGGGCTCTACAACCAGCAGGTGG + Intronic
924648991 1:245905680-245905702 GGGGCTCTACAATCAGCAGGTGG - Intronic
1063186414 10:3655936-3655958 TGTGTTCTCCATACAGCAGCTGG - Intergenic
1065467673 10:26043340-26043362 GGAGTTCTACAATCAGCAGGTGG + Intronic
1067536274 10:47112656-47112678 TGAGCTTCACATCAAGCAGGTGG - Intergenic
1071799345 10:89042097-89042119 TGGGCTCTACAATCAGCAGGTGG + Intergenic
1071963080 10:90824949-90824971 AGGGCTCTACAGCCAGCAGGTGG - Intronic
1072862777 10:99023462-99023484 GGAGCTCTACAATCAGCAAGTGG - Intronic
1073134245 10:101211229-101211251 TGAGCTCTGGAGACAGAAGGGGG - Intergenic
1073708122 10:106010232-106010254 GGTGCTCTACAATCAGCAGGTGG + Intergenic
1073827023 10:107336225-107336247 AGGGCTCTACAACCAGCAGGTGG + Intergenic
1074638026 10:115344159-115344181 GGGGCTCTACAATCAGCAGGTGG + Intronic
1075009306 10:118854002-118854024 TGAGCACCGCAAACAGCAGGAGG + Intergenic
1075195022 10:120348759-120348781 GGGGCTCTACAGTCAGCAGGTGG - Intergenic
1076080218 10:127573005-127573027 TGAGCTCTAAACACATTAGGTGG - Intergenic
1076094707 10:127721479-127721501 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1077228666 11:1449171-1449193 TGAGACCTGCACACAGCAGGAGG - Intronic
1079183594 11:18215617-18215639 GGGGCTCTACAATCAGCAGGTGG - Intronic
1079473802 11:20807576-20807598 AGGGCTCTGCATTCAGCAGGTGG + Intronic
1079961331 11:26927822-26927844 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1081212509 11:40354364-40354386 AGAGCTCTTCAGTCAGCAGGTGG + Intronic
1081780672 11:45709449-45709471 TGATCTATACATAAAGCAGAAGG - Intergenic
1083778703 11:64907056-64907078 GGTGCTTTACATACAGCAGGGGG + Intronic
1084121537 11:67071781-67071803 CGAGCCCTACACAGAGCAGGTGG - Exonic
1084763763 11:71294193-71294215 AGGGCTCTACAGTCAGCAGGTGG + Intergenic
1084792533 11:71483624-71483646 TGAGCTCAACAAACAGGATGGGG - Intronic
1085572034 11:77568338-77568360 AGAGATCTACAATCAGCAGGTGG + Intronic
1087031932 11:93715026-93715048 AGGGCTCTACAGTCAGCAGGTGG + Intronic
1087178552 11:95119694-95119716 TGGGCTCCACAATCAGCAGGTGG + Intronic
1087299396 11:96414230-96414252 AGAGCTCTACAATCAGCAGATGG - Intronic
1088045847 11:105449520-105449542 TGGGCTGTACAATCAGCAGGTGG - Intergenic
1088154766 11:106790034-106790056 TGGGCTCTAAAAGCAGCAGGTGG + Intronic
1091753463 12:3037062-3037084 TCAGCCCCACATCCAGCAGGAGG + Intronic
1092835042 12:12479414-12479436 TGATTTCTACATGGAGCAGGAGG + Intronic
1093608027 12:21118207-21118229 TGGGCTCTGCAGTCAGCAGGTGG + Intronic
1099799147 12:87435237-87435259 TGAGGTATACAAACAGCAGATGG - Intergenic
1101539743 12:105654072-105654094 TTAGCTCTCCTTTCAGCAGGTGG - Intergenic
1102318041 12:111905585-111905607 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1104103060 12:125633957-125633979 GGGGCTCTACAATCAGCAGGTGG + Intronic
1104634692 12:130430333-130430355 TGAGCCCCGCATCCAGCAGGAGG + Intronic
1104937337 12:132373291-132373313 AGAGCTCCACATCCAGCAGGAGG + Intergenic
1105767400 13:23575305-23575327 TGAGCTCCACTTACAGGAGGGGG + Intronic
1107754136 13:43600639-43600661 AGGGCTCTACAATCAGCAGGTGG - Intronic
1108973325 13:56403457-56403479 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1112006273 13:95256384-95256406 TGAGCCCTGCATCTAGCAGGTGG - Intronic
1112854650 13:103752711-103752733 TGAACTCAACATAAAGCAAGCGG - Intergenic
1115381535 14:32745698-32745720 GGGGCTCTACAGGCAGCAGGTGG + Intronic
1115463076 14:33683880-33683902 TGTGCTCTGCATACACCAAGAGG - Intronic
1115821084 14:37212683-37212705 TGAACTCTACAGTCAGCAGGAGG - Intronic
1115861279 14:37688404-37688426 AGAGCTCTACGATCAGCAGGTGG - Intronic
1116275511 14:42827059-42827081 AGAACTCTACAATCAGCAGGTGG + Intergenic
1116407149 14:44579815-44579837 GGTGCTCTACAATCAGCAGGTGG - Intergenic
1117504397 14:56388200-56388222 AGGGCTCTACAACCAGCAGGTGG + Intergenic
1117870863 14:60198705-60198727 CGAGCTCTTCAATCAGCAGGTGG - Intergenic
1118316103 14:64727075-64727097 AGAGCTTTACGAACAGCAGGTGG + Intronic
1119654668 14:76408621-76408643 TAAGCACTACATAGAGCAGTGGG + Intronic
1120003705 14:79333031-79333053 GGAGCTTTGCACACAGCAGGGGG - Intronic
1120949181 14:90025274-90025296 TGAACTAAAAATACAGCAGGTGG + Intronic
1123105581 14:105839709-105839731 GGGGCTGTACACACAGCAGGAGG - Intergenic
1125272376 15:37953178-37953200 GGGGCTCTACAATCAGCAGGTGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126534232 15:49742871-49742893 AGTGCTCTACAATCAGCAGGTGG - Intergenic
1127035273 15:54908918-54908940 TGGGCTCTACAATCAGCAGGTGG - Intergenic
1128683726 15:69668844-69668866 GGAGCCCTCCATATAGCAGGAGG + Intergenic
1129030529 15:72614738-72614760 GGGGCTCTACAGTCAGCAGGTGG + Intergenic
1129835426 15:78702511-78702533 GGGGCTCTACAGTCAGCAGGTGG + Intronic
1130321645 15:82847419-82847441 AGAGCTGGACACACAGCAGGAGG + Intronic
1130511888 15:84596090-84596112 AGGGCTCTACAGTCAGCAGGTGG - Intergenic
1130961797 15:88664285-88664307 AGTGCTCTACAATCAGCAGGTGG - Intergenic
1138488666 16:57363396-57363418 TGAGCCCTGCATAAAGTAGGTGG + Intronic
1142031709 16:87841752-87841774 AGAGCTCTGCACACAGCACGGGG - Intronic
1142281744 16:89152270-89152292 TGGGCGCTACTTAGAGCAGGGGG + Intronic
1142919656 17:3173004-3173026 AGGGCTCTACAGTCAGCAGGTGG - Intergenic
1143681759 17:8481074-8481096 TGAGCCCTGCACACCGCAGGGGG - Intronic
1143714467 17:8757134-8757156 TGAGCGCTCCATGCAGGAGGAGG - Intronic
1144853237 17:18254522-18254544 GGAGCTGTGCATGCAGCAGGGGG + Exonic
1144874983 17:18392804-18392826 TGAGCTGTCCCTACAGGAGGGGG - Intergenic
1144892475 17:18501891-18501913 TGAGCTCCACTGACAGCAGCAGG + Intergenic
1145139739 17:20442397-20442419 TGAGCTCCACTGACAGCAGCAGG - Intergenic
1145157241 17:20551617-20551639 TGAGCTGTCCCTACAGGAGGGGG + Intergenic
1145759630 17:27418866-27418888 TGAGCTATCCATACAGGAGGGGG - Intergenic
1145799410 17:27673471-27673493 TGAGCTGTCCATACAGGAAGGGG + Intergenic
1146159613 17:30552840-30552862 TGAGCTATCCATACAGGAGGGGG - Intergenic
1148119123 17:45197464-45197486 TGAGCTCTGGATCCAGCAGAAGG + Intergenic
1149679764 17:58497704-58497726 TGAGCTCAAAATACAACATGAGG + Intronic
1152129681 17:78468525-78468547 TTTGCTCTGCATAGAGCAGGAGG - Intronic
1153074739 18:1149116-1149138 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1153183187 18:2459118-2459140 AGGGCTCTACAATCAGCAGGTGG + Intergenic
1153453919 18:5259926-5259948 TGGGCTCTATAATCAGCAGGTGG - Intergenic
1153741029 18:8127823-8127845 TGAGCTCTACATAAGAGAGGAGG + Intronic
1154355285 18:13619849-13619871 TGAGCTGTGCAGAGAGCAGGTGG - Intronic
1155443504 18:25885657-25885679 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1155533888 18:26795465-26795487 TGGGTTCTACAATCAGCAGGTGG - Intergenic
1156789716 18:40956062-40956084 TGTTCTCTACATGCAGCATGGGG + Intergenic
1157937059 18:51884497-51884519 AGATCTCTACAATCAGCAGGTGG - Intergenic
1160587848 18:79922722-79922744 TGACCTCTCCTTACAGCAGCAGG + Intronic
1162936978 19:13986271-13986293 TGAGCAGGACCTACAGCAGGAGG + Intronic
1164881110 19:31733715-31733737 TGAGCTCTACATAAAGAACGTGG - Intergenic
1166227584 19:41406181-41406203 TGTGCTCCACATACTGCAGCTGG - Intronic
1168241761 19:55092311-55092333 GCAGCTCTGCATACAGCTGGGGG + Exonic
925650387 2:6083308-6083330 GGAGATCTACACACAGCATGGGG - Intergenic
926602122 2:14855885-14855907 GGGGCTCTACAATCAGCAGGTGG - Intergenic
927309704 2:21616951-21616973 GGGGCTCTACAATCAGCAGGTGG + Intergenic
927594645 2:24385942-24385964 TGAGTTCTACAATCAGCAGGTGG + Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
928293637 2:30061744-30061766 AGAGCTCTACCATCAGCAGGTGG - Intergenic
928862383 2:35874663-35874685 CGGGCTCTACAATCAGCAGGTGG + Intergenic
929210989 2:39356940-39356962 TCAGCTCTACAAACAGCCTGTGG - Intronic
930727491 2:54695846-54695868 GGAGCTCTACATTCAGTAGGTGG - Intergenic
930878220 2:56244100-56244122 AGGGCTCTACAATCAGCAGGTGG + Intronic
932648714 2:73532272-73532294 GGGGCTCTACAATCAGCAGGTGG + Intronic
933348902 2:81127833-81127855 GGGGCTCTACAATCAGCAGGTGG + Intergenic
933593356 2:84258051-84258073 TTAGCTGTAGAAACAGCAGGTGG - Intergenic
933653734 2:84870497-84870519 TGAGCTTGACATACTCCAGGTGG + Exonic
933997021 2:87677491-87677513 TGGGCTTTGCATAGAGCAGGTGG + Intergenic
936296828 2:111273419-111273441 TGGGCTTTGCATAGAGCAGGTGG - Intergenic
939682946 2:145161321-145161343 AGAGTTCTAAATACAGCTGGTGG + Intergenic
940082147 2:149815223-149815245 AGATCTTTACATACAGCAGATGG + Intergenic
942352418 2:175066057-175066079 GGAGCTCTAAAATCAGCAGGTGG - Intergenic
942986177 2:182145037-182145059 TGAGGTCTAAAAACAACAGGAGG - Intronic
943118867 2:183709748-183709770 GGGGCTCTACAATCAGCAGGTGG + Intergenic
943923381 2:193738955-193738977 GGGGCTCTACAGTCAGCAGGTGG - Intergenic
944046260 2:195414701-195414723 AGGGCTCTACAATCAGCAGGTGG - Intergenic
944078726 2:195760388-195760410 GGGGCTCTACAGTCAGCAGGTGG - Intronic
947312256 2:228817713-228817735 GGAGCTCTACAATCAGCAGGTGG + Intergenic
1170086874 20:12544015-12544037 GGGGCTCTACAACCAGCAGGTGG + Intergenic
1173098999 20:40065961-40065983 GGAGGTCTACAATCAGCAGGTGG - Intergenic
1174856423 20:54049765-54049787 GGAGCTCTAAAAACAGCAGCTGG - Intronic
1176044384 20:63084727-63084749 TGAGCTCTGCATGCAGCTGCCGG + Intergenic
1176259357 20:64171516-64171538 GGAGCTCCACATCCAGCAGCAGG - Intronic
1177456410 21:21344744-21344766 AGGGCTCTACAATCAGCAGGAGG - Intronic
1177740544 21:25148208-25148230 ATAGCTCTACAGTCAGCAGGTGG + Intergenic
1178744912 21:35239879-35239901 TGTGCTGTACATACTGCAGCAGG - Intronic
1179053379 21:37908926-37908948 TCAGCTCTATATCCAGGAGGAGG - Intronic
1179326884 21:40355284-40355306 TGAGCACTACCGACAGCATGTGG + Intronic
1179453322 21:41480326-41480348 TGAGCCCTATAACCAGCAGGTGG - Intronic
1179652587 21:42821226-42821248 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG + Intronic
1182091290 22:27596673-27596695 TGAGCACTACATTGAGGAGGGGG - Intergenic
1183497300 22:38154215-38154237 AGGGCTCTACAGTCAGCAGGTGG - Intronic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
950358959 3:12437005-12437027 TGGGCTCCACACACAGCGGGAGG - Intergenic
951032148 3:17894937-17894959 GGGGCTCTACAGTCAGCAGGTGG + Intronic
953229294 3:41050384-41050406 AGGGCTCTACAATCAGCAGGTGG + Intergenic
953722658 3:45369710-45369732 GGGGCTCTACAATCAGCAGGTGG - Intergenic
954491623 3:50912470-50912492 GGTGCTCTACAGTCAGCAGGTGG + Intronic
956849501 3:73215863-73215885 TGAGATCTACTTATAGGAGGGGG + Intergenic
957907554 3:86577845-86577867 AGGGCTCTACAATCAGCAGGTGG + Intergenic
958760232 3:98297507-98297529 AGAGCTTTACAAAGAGCAGGTGG - Intergenic
959113540 3:102149409-102149431 TGGGCTCTACAATCAGTAGGTGG - Intronic
959303989 3:104636319-104636341 GGGGCTCTACAATCAGCAGGTGG - Intergenic
959724932 3:109532766-109532788 GGGGCTCTACAATCAGCAGGTGG + Intergenic
960498997 3:118412409-118412431 AGAGCTCTACATTTAGAAGGTGG - Intergenic
960541103 3:118863896-118863918 GGGGCTCTATATTCAGCAGGTGG + Intergenic
962015238 3:131432209-131432231 CGAGCTCTTCAGTCAGCAGGTGG - Intergenic
962078654 3:132114061-132114083 AGGGCTCTACAATCAGCAGGTGG + Intronic
962120973 3:132559578-132559600 TGGGCTGTAGATACAGCATGGGG - Intronic
962152024 3:132903168-132903190 GGGGCTCTACAATCAGCAGGTGG - Intergenic
962414064 3:135166777-135166799 AGAGCTCTAACTGCAGCAGGAGG + Intronic
962672659 3:137725257-137725279 TATGCTCTACCCACAGCAGGAGG - Intergenic
962698926 3:137978467-137978489 GGGGCTCTACAATCAGCAGGTGG + Intergenic
962759037 3:138492215-138492237 AGAGTTCTACAATCAGCAGGTGG + Intergenic
963763270 3:149307374-149307396 AGGGCTCTACAGTCAGCAGGTGG + Intergenic
964523277 3:157589811-157589833 TAATTTCTACATACAGCAGAAGG + Intronic
965175161 3:165321921-165321943 AGAGCTCTACAATCAGCAGGTGG + Intergenic
966312955 3:178615302-178615324 GGGGCTCTACAGTCAGCAGGTGG + Intronic
970011079 4:11459825-11459847 AGGGCTCTACAATCAGCAGGTGG - Intergenic
970071134 4:12161593-12161615 GGGGCTCTACAACCAGCAGGTGG + Intergenic
970316106 4:14829772-14829794 TAAGCTCAACATACTACAGGAGG + Intergenic
970599084 4:17626792-17626814 TGTGTTCTACAAACAGCAGCTGG + Exonic
970892895 4:21067601-21067623 AGGGCTCTACACTCAGCAGGTGG - Intronic
972165085 4:36274231-36274253 AGAGCTCTAGATACAGCAGAAGG - Intergenic
972272132 4:37522107-37522129 GGAGCTCTACAATCAGCTGGTGG + Intronic
972904542 4:43728631-43728653 TGGGCTCTACAATCAGCAGGTGG - Intergenic
975252804 4:72198731-72198753 ACAGCTCTACAACCAGCAGGTGG - Intergenic
976171632 4:82310744-82310766 AGAGCTCTACAATCAGCAGGTGG + Intergenic
977184967 4:93925507-93925529 GGGGCTCTACAATCAGCAGGTGG - Intergenic
977399225 4:96510376-96510398 GGGGTTCTACATACAGCAGGTGG - Intergenic
977873604 4:102123428-102123450 AGGGCTCTACAATCAGCAGGTGG + Intergenic
978112501 4:104979172-104979194 AGAGCTCTACAATCAGCAGGGGG - Intergenic
978254678 4:106680216-106680238 TGAGCTGTAAACACAGCAGGAGG - Intergenic
978520432 4:109609803-109609825 AGAACTCTACAATCAGCAGGTGG + Intronic
978857022 4:113404925-113404947 TGAGCTCTCAAGACAGCAGCTGG - Intergenic
978934520 4:114359025-114359047 AGAGCTCTACAAACAGCAATGGG + Intergenic
979573077 4:122252767-122252789 AGAGCTGTACAATCAGCAGGTGG - Intronic
980443043 4:132871806-132871828 GGGGCTCTACATTCAGCAAGTGG - Intergenic
981140317 4:141259956-141259978 AGAGCTCTACAATCAGCATGTGG - Intergenic
981298023 4:143155815-143155837 GGGGCTCTACAATCAGCAGGTGG + Intergenic
981895736 4:149796527-149796549 GGGGCTCTACAATCAGCAGGTGG - Intergenic
982615381 4:157634229-157634251 AGGGCTCTACAATCAGCAGGTGG - Intergenic
982828213 4:160027026-160027048 TAGGCTCTACAATCAGCAGGTGG + Intergenic
982932775 4:161429329-161429351 TGGGCTCTACAATCAGCAGGTGG - Intronic
987616188 5:20277118-20277140 AGGGCTCTAAAAACAGCAGGTGG - Intronic
987903961 5:24051277-24051299 TGGCCTCTACAATCAGCAGGTGG - Intronic
988299568 5:29404541-29404563 GGAGCTCTACAATCAACAGGTGG - Intergenic
988384288 5:30540413-30540435 AGGGCTCTACAGTCAGCAGGTGG - Intergenic
989726412 5:44591813-44591835 TGCGCTCTACATACATAAGTAGG + Intergenic
990023507 5:51158150-51158172 TGAGCTCTTCTTTCAACAGGAGG + Intergenic
991180517 5:63746303-63746325 GGAGCTCTACAATCAGCGGGAGG + Intergenic
993215897 5:85021995-85022017 TGAGCTCTACATTGAGCAACGGG + Intergenic
994235532 5:97358133-97358155 GGGGCTCTACAATCAGCAGGTGG + Intergenic
994530045 5:100957312-100957334 GGGGCTCTACAATCAGCAGGTGG - Intergenic
995278490 5:110306806-110306828 GGGGCTTTACATTCAGCAGGTGG + Intronic
996666640 5:126067185-126067207 AGGGCTCTACAATCAGCAGGTGG - Intergenic
996927624 5:128846615-128846637 GGGGCTCTACAATCAGCAGGTGG - Intronic
996961431 5:129255126-129255148 GGGGCTCTACAGTCAGCAGGTGG + Intergenic
997748243 5:136318741-136318763 TGAGCTGGACATATAGGAGGTGG - Intronic
997905125 5:137808771-137808793 TGACCTCTACACCCACCAGGTGG + Intergenic
999002442 5:147939283-147939305 GGGGCTCTACAATCAGCAGGTGG + Intergenic
999345729 5:150817390-150817412 GGGGCTCTACAATCAGCAGGTGG - Intergenic
999849412 5:155522737-155522759 AGGGCTCTACAATCAGCAGGTGG + Intergenic
1000247253 5:159459016-159459038 TGGGTTCTACACAAAGCAGGAGG - Intergenic
1000399561 5:160811810-160811832 GGAGCTCTAAAATCAGCAGGTGG - Intronic
1000951165 5:167485086-167485108 TGAGGTCTTCATCCAGCCGGTGG + Intronic
1001177743 5:169487373-169487395 GGGGCTCTACAGTCAGCAGGTGG - Intergenic
1001194020 5:169655275-169655297 TGTGCCCTCCATGCAGCAGGAGG - Intronic
1001637240 5:173219682-173219704 TTAGCTATACATACAGCATGAGG + Intergenic
1001654960 5:173342276-173342298 CGAGCTCTACTCCCAGCAGGAGG - Intergenic
1002198528 5:177513983-177514005 TGTGCTATACATAGGGCAGGTGG - Intronic
1002961022 6:1915007-1915029 TGGGCTCCAGCTACAGCAGGTGG + Intronic
1003952238 6:11127165-11127187 AGGGCTCTACAATCAGCAGGTGG + Intronic
1005097692 6:22136005-22136027 GGAGCTTTACATAAAACAGGTGG + Intergenic
1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG + Intronic
1008177532 6:48287633-48287655 GGGGCTCTACAAATAGCAGGTGG + Intergenic
1008227198 6:48935851-48935873 GGAGCTCTACAACCAGTAGGTGG + Intergenic
1008250275 6:49231605-49231627 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1009622866 6:66097993-66098015 TCAGCTCTAAATACAGCATGGGG + Intergenic
1011019040 6:82789870-82789892 AGGGCTCTACAAACAACAGGTGG - Intergenic
1011024011 6:82846080-82846102 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1011144946 6:84203902-84203924 TGAGCTCTTCATATAGCAATAGG + Intronic
1012679025 6:102154613-102154635 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1014378900 6:120714115-120714137 TGGGCTCTACAATCAGCAGGTGG - Intergenic
1014383497 6:120773500-120773522 TCAGCTCTACATACCAAAGGGGG + Intergenic
1014862353 6:126485129-126485151 AGAGCTCTACAATCAGCAGATGG - Intergenic
1015372050 6:132465284-132465306 TGAGCTCTAGAGATAGAAGGTGG - Intronic
1016229873 6:141789534-141789556 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1016251648 6:142049656-142049678 TGGGCTCTACAATCAGCAGGTGG - Intergenic
1016643729 6:146380135-146380157 TGGGCTCTACAGTCAGCAAGTGG + Intronic
1018723017 6:166588234-166588256 TCAGCTTCACATTCAGCAGGTGG + Intronic
1018949379 6:168369236-168369258 TGAGCAGTACATACAGAAGGAGG - Intergenic
1019624218 7:2007711-2007733 TGGGCTCTACATCCAGGAGTAGG - Intronic
1020624306 7:10558630-10558652 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1021034882 7:15785413-15785435 GGGGCTCTACAATCAGCAGGGGG - Intergenic
1021382322 7:19983330-19983352 GGAGCTCTACAATCAGCATGAGG + Intergenic
1022541939 7:31145861-31145883 AGGGCTGTACATTCAGCAGGTGG + Intergenic
1023913521 7:44571625-44571647 TGAGCAGGGCATACAGCAGGAGG + Exonic
1024369028 7:48559060-48559082 AGGGCTCTACAATCAGCAGGTGG + Intronic
1026550257 7:71362412-71362434 GGAGATCTGCACACAGCAGGCGG - Intronic
1027604965 7:80288588-80288610 AGGGCTCTACAATCAGCAGGGGG - Intergenic
1027674795 7:81143800-81143822 AGAGCTCTACAATCAGCAAGTGG - Intergenic
1028264375 7:88705169-88705191 TGGGCTCTACCATCAGCAGGTGG + Intergenic
1029797217 7:102908927-102908949 GGGGCTCTACAATCAGCAGGTGG + Intronic
1031231536 7:119114012-119114034 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1031639033 7:124139799-124139821 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1031657915 7:124380727-124380749 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1031758691 7:125682072-125682094 TGGGCTCTACAATAAGCAGGTGG - Intergenic
1035214640 7:157356085-157356107 TGAGCACTATATATAGCAAGAGG - Intronic
1035550894 8:523914-523936 AGGGCTCTACAATCAGCAGGTGG - Intronic
1037865099 8:22437127-22437149 TGAGATCTAAATACAGTAGTCGG - Intergenic
1041500317 8:58533034-58533056 AGAGCTCTACAATCAGCAAGTGG + Intergenic
1043340194 8:79229127-79229149 GGAGCTCTACAATCAGCATGTGG + Intergenic
1044431232 8:92109633-92109655 GGAGCTCTGCATATAGAAGGAGG - Intergenic
1045207181 8:100055120-100055142 TGGGCTCTACAATTAGCAGGTGG - Intronic
1046400005 8:113692375-113692397 TCAGCAATAAATACAGCAGGGGG - Intergenic
1047841246 8:128755307-128755329 AGAGCTCTACAGTCAGCAGGTGG - Intergenic
1047901182 8:129423668-129423690 AGTGCTCTACAATCAGCAGGTGG - Intergenic
1047910191 8:129519121-129519143 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1048706144 8:137155737-137155759 AGTGCTCTACAATCAGCAGGTGG + Intergenic
1049828219 8:144684358-144684380 TGCCCTCTATAGACAGCAGGTGG - Intergenic
1050004887 9:1119584-1119606 CAGGCTCTACATACAGCAGCAGG + Intergenic
1051266155 9:15310662-15310684 AGTGCTATACATACAGCAGGAGG - Intergenic
1055073777 9:72193671-72193693 GGGGCTCTACAATCAGCAGGTGG + Intronic
1055579882 9:77697746-77697768 AGGGCTCTACAGTCAGCAGGTGG + Intergenic
1055821462 9:80269772-80269794 TTAGCTCTCCATAAAGCAAGGGG - Intergenic
1055827097 9:80339771-80339793 AGAGCTCTACAATCAGCAGGTGG - Intergenic
1056424602 9:86464501-86464523 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1057206347 9:93175241-93175263 CGAGCTCCACACCCAGCAGGTGG - Intergenic
1058956439 9:109953225-109953247 TGAACTCTAAATATAGCAGGAGG + Intronic
1061308429 9:129746281-129746303 TGAGCTGTCCAGGCAGCAGGAGG - Intronic
1186507863 X:10108553-10108575 TGAGGTCTAGACCCAGCAGGTGG + Intronic
1187889416 X:23920184-23920206 AGGGCTCTACAGTCAGCAGGTGG + Intronic
1188068770 X:25694590-25694612 GGAGTTCTACAGTCAGCAGGTGG + Intergenic
1188083306 X:25872559-25872581 TCAGCTGTAGCTACAGCAGGTGG - Intergenic
1188715701 X:33456955-33456977 TGGGCTCTACAATCAGCAGATGG - Intergenic
1189769977 X:44416223-44416245 TGGCCTCTACAATCAGCAGGTGG + Intergenic
1190046346 X:47114089-47114111 AGAGCTCTACAATGAGCAGGTGG - Intergenic
1190368204 X:49717146-49717168 AGGGCTCTACAATCAGCAGGTGG + Intergenic
1190808254 X:53860390-53860412 AGGGCTCTACAATCAGCAGGCGG + Intergenic
1190893797 X:54596584-54596606 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1192062242 X:67839343-67839365 GGGACTCTACATTCAGCAGGTGG - Intergenic
1192278921 X:69663292-69663314 TGGGCTGCACATACAGCAGGGGG - Intronic
1192304345 X:69943703-69943725 AGGGCTCTACAATCAGCAGGTGG + Intronic
1192406114 X:70887687-70887709 AGAGCTCTACAACCAGCAGGTGG - Intronic
1192822333 X:74658163-74658185 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1192839096 X:74835794-74835816 TGGGCTCTACAACCAGCAGGTGG + Intronic
1192841258 X:74858131-74858153 AGAGCTCTACAGTCAACAGGTGG - Intronic
1192941017 X:75911896-75911918 TGGGCTCTACAGTCAGCAGGTGG + Intergenic
1193337309 X:80306286-80306308 GGAGCTCTACAATCAGCAGTTGG + Intergenic
1193664678 X:84300698-84300720 GGGGCTCTACAGTCAGCAGGTGG - Intergenic
1193755817 X:85407946-85407968 GCAGCTCTACAGTCAGCAGGTGG + Intergenic
1193957854 X:87885303-87885325 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1194288451 X:92039244-92039266 AGGGCTCTACAATCAGCAGGTGG + Intronic
1194506693 X:94742749-94742771 GGAGCTCTACAATCACCAGGTGG + Intergenic
1194591602 X:95805984-95806006 AGGGCTTTACATTCAGCAGGTGG - Intergenic
1194595240 X:95848756-95848778 GGGGCTGTACATTCAGCAGGTGG - Intergenic
1194839664 X:98725434-98725456 AGGGCTCTACAGTCAGCAGGTGG + Intergenic
1194925386 X:99817673-99817695 TGGGCTCTACAATCATCAGGGGG - Intergenic
1195199984 X:102539409-102539431 AGAGCTCTACAATCAGCAGATGG + Intergenic
1196247475 X:113416221-113416243 GGGGCTCTATAAACAGCAGGTGG - Intergenic
1196512017 X:116523340-116523362 AGGGCTCTACATTCAGCAGGTGG + Intergenic
1196573375 X:117289247-117289269 TGGGCTCTACAAAGAGCAGGTGG - Intergenic
1196600847 X:117600343-117600365 GGGGCTCTACAATCAGCAGGGGG + Intergenic
1196865448 X:120066583-120066605 TGGGCTCTACAATGAGCAGGTGG - Intergenic
1196877646 X:120169697-120169719 TGGGCTCTACAATGAGCAGGTGG + Intergenic
1197520305 X:127489622-127489644 AGGGCTCTACAGTCAGCAGGAGG + Intergenic
1197661447 X:129178461-129178483 TGGGCTTTACAATCAGCAGGTGG + Intergenic
1197987059 X:132278163-132278185 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1198773639 X:140156446-140156468 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1198982027 X:142408931-142408953 TGGGCTCTACAATCAGCTGGTGG - Intergenic
1199163828 X:144647254-144647276 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1199191901 X:144980763-144980785 TGGGCTCTACAATCAGCAGGTGG - Intergenic
1199274714 X:145927099-145927121 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1199317251 X:146395331-146395353 GGAGCTCTACAATGAGCAGGTGG + Intergenic
1199358389 X:146887216-146887238 TGGGCTCTGCAATCAGCAGGTGG - Intergenic
1199455107 X:148019936-148019958 GGGACTCTACAAACAGCAGGTGG + Intronic
1199535023 X:148892943-148892965 AGAGCTCTAGAAACAGCAGATGG + Intronic
1199645844 X:149909841-149909863 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1200605972 Y:5263809-5263831 AGGGCTCTACAATCAGCAGGTGG + Intronic
1200818768 Y:7560861-7560883 TGTGCTCTATTTAAAGCAGGTGG - Intergenic