ID: 1005887479

View in Genome Browser
Species Human (GRCh38)
Location 6:30107809-30107831
Sequence TGCGAGAGCCATAGAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005887479_1005887485 -10 Left 1005887479 6:30107809-30107831 CCAGGCCCTCTATGGCTCTCGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1005887485 6:30107822-30107844 GGCTCTCGCAGGAGTCAGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005887479 Original CRISPR TGCGAGAGCCATAGAGGGCC TGG (reversed) Intronic
900175124 1:1288122-1288144 TGGGAGAGTACTAGAGGGCCTGG + Intronic
901810558 1:11764757-11764779 TAAGAAAGCCACAGAGGGCCGGG + Intronic
902212739 1:14915401-14915423 TTTGAGAGACACAGAGGGCCAGG - Intronic
902337406 1:15761327-15761349 TCCGAGTGCCATGGATGGCCTGG + Intronic
902520319 1:17011962-17011984 TGCGAGGGCCGCAGAGGGCCGGG - Intergenic
902874586 1:19333157-19333179 TGAGAGAGCCAGGGAGGGCGCGG - Intergenic
903470879 1:23586496-23586518 TGCAAGAGCCCTAGAAGGGCTGG - Intronic
907096819 1:51789590-51789612 TTCAAGGCCCATAGAGGGCCAGG - Exonic
913190424 1:116408562-116408584 TGTGAGAGCATTAGAGGCCCAGG - Intronic
914228029 1:145738094-145738116 TGAGAGAGGCACAGAGGTCCAGG - Intronic
915324487 1:155073855-155073877 GGAGAGAGCCTCAGAGGGCCAGG - Intergenic
917839922 1:178969467-178969489 TGAGTGAGCCACAGAGGGACTGG - Intergenic
920340745 1:205273792-205273814 TGCTGCAGCCACAGAGGGCCTGG - Intergenic
922583441 1:226716104-226716126 TGTAAAAGCAATAGAGGGCCAGG - Intronic
924288064 1:242508783-242508805 TCTAAAAGCCATAGAGGGCCAGG + Intronic
1069574480 10:69516978-69517000 TGTGTGAGCCCCAGAGGGCCAGG + Intergenic
1072781262 10:98253368-98253390 GGCGAGAGCGATGGAGGGGCAGG + Intronic
1073956202 10:108874298-108874320 TGGGAGAGTCATAGAGGTGCTGG - Intergenic
1074855072 10:117467363-117467385 TGCGCGAGCCAGAGAGAACCAGG + Intergenic
1076474593 10:130743438-130743460 TACGAGAGTCTGAGAGGGCCCGG - Intergenic
1076943034 10:133622625-133622647 GGCGACACCCACAGAGGGCCTGG - Intergenic
1077555615 11:3224626-3224648 TTCGAGAGACTGAGAGGGCCGGG - Intergenic
1077663447 11:4088922-4088944 TGAGAGAGGCATAGAAGGACAGG + Intronic
1078420777 11:11210345-11210367 TATGAGAGCCACACAGGGCCTGG - Intergenic
1083903213 11:65653923-65653945 TGCCAGTGCCATACAGGGGCTGG + Exonic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085471455 11:76761048-76761070 TGGGAGAGGTACAGAGGGCCAGG + Intergenic
1095708111 12:45259558-45259580 TGCTGGAGCCACGGAGGGCCTGG + Intronic
1100415711 12:94371724-94371746 TCCTAGAGCCAAAGAGGGCAAGG + Intronic
1104621918 12:130320403-130320425 TGGGAGGGCCAGAGAGGGACAGG + Intergenic
1113032204 13:106006663-106006685 TGCAAGAGCCATAAAAGGTCAGG + Intergenic
1118321119 14:64753925-64753947 TGGGAGAGCCAGGGTGGGCCAGG - Intronic
1121740187 14:96246411-96246433 TGCTGGAGCCAGAGAGGGTCAGG - Intronic
1122227224 14:100286803-100286825 TGCAAGAACCAGAGGGGGCCTGG - Intergenic
1129325829 15:74799899-74799921 TGCGAGAGCCTCAGGGGCCCTGG - Intronic
1129450602 15:75649117-75649139 TGTGAAAGTCATAGAGGGCTCGG - Exonic
1132939287 16:2499006-2499028 TGTGGGAGCCAAAGAGGCCCTGG - Intronic
1133341584 16:5039967-5039989 TGAGAGAGCAAGAGAGGGCGGGG - Intronic
1139660166 16:68415209-68415231 AGTGAGACCCAAAGAGGGCCAGG + Intronic
1143969965 17:10788354-10788376 AGCGAGAGCCATGGAGGGAAAGG + Intergenic
1144051100 17:11497767-11497789 TGCGAGAGACAGAGAAGGCCAGG - Intronic
1145109934 17:20153624-20153646 TGAGAGAGCCATAGGAGTCCAGG + Intronic
1145267660 17:21388236-21388258 TGGGTGAGCCATAGAGACCCAGG - Intronic
1150492209 17:65582285-65582307 TGCTAGAGGCTTATAGGGCCAGG - Intronic
1151959339 17:77397266-77397288 TGCCAGAGCCAAGGAGCGCCTGG - Intronic
1152865876 17:82722667-82722689 TGCCAGAGACAAACAGGGCCTGG - Intronic
1157873576 18:51251696-51251718 TGCAAGAGCCAGATGGGGCCAGG - Intergenic
1160681378 19:413086-413108 AGCTGGTGCCATAGAGGGCCAGG - Intergenic
1160681415 19:413198-413220 AGCTGGTGCCATAGAGGGCCAGG - Intergenic
1160681440 19:413272-413294 AGCCGGTGCCATAGAGGGCCAGG - Intergenic
1160681465 19:413346-413368 AGCCGGTGCCATAGAGGGCCAGG - Intergenic
1163556852 19:17998128-17998150 TGCGGGAGACAGAGAGGGGCAGG - Intronic
1166871942 19:45876607-45876629 AGCGACAGGAATAGAGGGCCTGG - Intergenic
926806780 2:16718417-16718439 TGGGAGAGCCAGAGAAGGCAAGG - Intergenic
928195929 2:29216413-29216435 TGCGAGGGCCATAGATGTCTCGG + Intronic
937011518 2:118567018-118567040 TACGAGAAGCATAGAGGGCTGGG - Intergenic
940116887 2:150219319-150219341 TGGGAGAGCATTAGAGGACCTGG + Intergenic
946568937 2:220999855-220999877 TGCCTGAGCCCAAGAGGGCCAGG - Intergenic
947838339 2:233190743-233190765 TGAGAGAGGCAGAGAGAGCCTGG + Intronic
948348336 2:237318027-237318049 TTCCAGATCCAGAGAGGGCCTGG - Intergenic
948551378 2:238775136-238775158 TGAGAGAGCAAAAGAGGACCAGG + Intergenic
948619359 2:239224447-239224469 TGCGGGAGACATAAAAGGCCGGG - Intronic
948892424 2:240913990-240914012 TGGGAGGGCCATGGAGGGCCCGG + Intergenic
1169278083 20:4246927-4246949 TGGGAGAGGCAGAGAAGGCCCGG + Intronic
1172487545 20:35307365-35307387 TGCTGGGGCCACAGAGGGCCAGG + Intronic
1174354864 20:49990815-49990837 TGAGAAAGCCAGAGGGGGCCAGG + Intergenic
1174667293 20:52271949-52271971 TGCATGAGCCATCTAGGGCCAGG + Intergenic
1179457273 21:41508161-41508183 AGCGAGAGCCAGGGCGGGCCGGG - Intronic
1181625743 22:24121057-24121079 GGCGAGGGCCAGAGAGGGCCAGG + Intronic
1182109909 22:27715636-27715658 TGGGGCAGCCATTGAGGGCCTGG + Intergenic
1183933016 22:41246837-41246859 TGCGAGAGGCTCAGAGAGCCAGG + Intronic
1184219350 22:43089352-43089374 TGCGAGCGCCGGAGAGGGGCTGG - Exonic
1184773832 22:46613427-46613449 TGCTGGAGGCACAGAGGGCCAGG + Intronic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
954522734 3:51243394-51243416 CTCCAGAGCCATCGAGGGCCAGG + Intronic
956014621 3:64868544-64868566 TGGGAGTGCTATAGTGGGCCAGG + Intergenic
957350701 3:79019207-79019229 TGCGAGCGCCCCAGAGGGCGAGG - Intronic
957710279 3:83848523-83848545 TGAGAGGGCCATACAGGGCCTGG - Intergenic
967228203 3:187313057-187313079 TGCGAGAGACAGAGATGGCATGG - Intergenic
968948340 4:3677221-3677243 GGAGAGAGCCAGAGAGGGACCGG - Intergenic
971366706 4:25983468-25983490 TGCGAGAGAAACAGAGGGTCAGG - Intergenic
973811201 4:54571953-54571975 TGCAGGAGCCATAGAGACCCAGG + Intergenic
981807055 4:148728775-148728797 TGGGAGGGCCATTGTGGGCCCGG + Intergenic
985130619 4:186734972-186734994 AGCGAGAGCGAGAGAGAGCCAGG - Intergenic
985446388 4:190023067-190023089 GGCGACACCCACAGAGGGCCTGG - Intergenic
986338651 5:6772742-6772764 TGAGGGAGCCAGAGAGGGGCTGG - Intergenic
989396575 5:40963519-40963541 TGATAGAGCCAGAGTGGGCCAGG + Intronic
994897958 5:105729714-105729736 AGGGAGAGTCATAGAGGGGCAGG + Intergenic
997201677 5:132013478-132013500 TGCCAGAGCCGCATAGGGCCCGG - Intergenic
999141998 5:149368441-149368463 GGCGGGAGCCATAGAGGGGATGG - Exonic
999265906 5:150266825-150266847 TGAGAGGGCCATTCAGGGCCAGG - Intronic
1001482078 5:172095540-172095562 TGTCAGAGCTGTAGAGGGCCCGG + Intronic
1005743009 6:28810250-28810272 TGGGAGAGAGATAGAGGGCAAGG + Intergenic
1005880789 6:30058577-30058599 TGATAGAGTCAGAGAGGGCCCGG - Intergenic
1005887479 6:30107809-30107831 TGCGAGAGCCATAGAGGGCCTGG - Intronic
1007414354 6:41683356-41683378 TGCCAGAGCCAGAGCGGGGCGGG + Intergenic
1008538741 6:52528174-52528196 AGCGAGAGCCAAGGAGGGGCTGG - Intronic
1008819024 6:55608947-55608969 TGCGTGAGCCACACAGGGCAGGG + Intergenic
1022172248 7:27841447-27841469 AGCAAGAGGCATAGAAGGCCAGG + Intronic
1023472279 7:40536546-40536568 TGAGATAGCCACATAGGGCCAGG + Intronic
1023552913 7:41388533-41388555 TCCGAGTGCCAGAGAAGGCCGGG - Intergenic
1024600163 7:50973622-50973644 TGATAGAGCCACAGAGGGACGGG - Intergenic
1025255734 7:57382892-57382914 TGCGGGAGCCACAGGGGCCCTGG - Intergenic
1027267791 7:76503718-76503740 GGCCAGAGCCATGGAGGGCCGGG + Intronic
1028936136 7:96466040-96466062 AGCAAGAGCCAGAGATGGCCTGG - Intergenic
1031528643 7:122850811-122850833 TGCCAGTGCCATAGAGGAGCTGG - Intronic
1032855693 7:135832093-135832115 TACTGGAGCCATAGAGGGCTTGG + Intergenic
1034528971 7:151683739-151683761 TGCCACAGCCAGAGAGGGACAGG + Intronic
1039658149 8:39433151-39433173 TCAGAGAGCCATACAGGGCAGGG + Intergenic
1048078384 8:131098077-131098099 TGGGAGAGGGAGAGAGGGCCTGG + Intergenic
1050783230 9:9365757-9365779 TGAGAGACCCATAGAGAGACTGG - Intronic
1057051055 9:91924416-91924438 TGTGATTCCCATAGAGGGCCTGG - Intronic
1060262308 9:122087041-122087063 TGGCAGAGCCATCCAGGGCCTGG - Intronic
1060966330 9:127714286-127714308 TGGGAGAGCCAGAGAGGCCCAGG + Intronic
1061195866 9:129106789-129106811 TGGGAGAGCCAGAGCGGGTCCGG - Intronic
1062503895 9:136863129-136863151 TGCGAGAGGCAGTGAGAGCCGGG + Intronic
1189168266 X:38883405-38883427 GGGGAGTGCCATAGAGGGCCAGG - Intergenic
1192187112 X:68955126-68955148 TGAGGTATCCATAGAGGGCCTGG + Intergenic
1192639137 X:72846454-72846476 GGCGAGGGCCACAGAGGCCCAGG + Intronic
1192642574 X:72874351-72874373 GGCGAGGGCCACAGAGGCCCAGG - Intronic
1195541595 X:106068638-106068660 TCCCAGAGACATAGTGGGCCAGG + Intergenic