ID: 1005894227

View in Genome Browser
Species Human (GRCh38)
Location 6:30164102-30164124
Sequence CAGGATGATGTCCTGTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005894216_1005894227 22 Left 1005894216 6:30164057-30164079 CCCTACCGGGTAAGAAGTGTAGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1005894227 6:30164102-30164124 CAGGATGATGTCCTGTTATGAGG 0: 1
1: 0
2: 0
3: 11
4: 129
1005894215_1005894227 30 Left 1005894215 6:30164049-30164071 CCATTCAGCCCTACCGGGTAAGA 0: 1
1: 1
2: 0
3: 1
4: 50
Right 1005894227 6:30164102-30164124 CAGGATGATGTCCTGTTATGAGG 0: 1
1: 0
2: 0
3: 11
4: 129
1005894225_1005894227 -5 Left 1005894225 6:30164084-30164106 CCTAGGGCCTGTTTGGGGCAGGA 0: 1
1: 0
2: 0
3: 25
4: 250
Right 1005894227 6:30164102-30164124 CAGGATGATGTCCTGTTATGAGG 0: 1
1: 0
2: 0
3: 11
4: 129
1005894217_1005894227 21 Left 1005894217 6:30164058-30164080 CCTACCGGGTAAGAAGTGTAGCT 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1005894227 6:30164102-30164124 CAGGATGATGTCCTGTTATGAGG 0: 1
1: 0
2: 0
3: 11
4: 129
1005894218_1005894227 17 Left 1005894218 6:30164062-30164084 CCGGGTAAGAAGTGTAGCTTTAC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1005894227 6:30164102-30164124 CAGGATGATGTCCTGTTATGAGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005894227 Original CRISPR CAGGATGATGTCCTGTTATG AGG Intronic
900466851 1:2829944-2829966 CAGGATGATGGCCTGGGATGTGG + Intergenic
903357756 1:22758534-22758556 CAGCATGGTGTCCTGCTTTGTGG - Intronic
905415460 1:37800721-37800743 CAGGATGATTTCCTGATAATTGG - Exonic
909237570 1:73173358-73173380 CTGAATGATGGCCTTTTATGGGG - Intergenic
914451790 1:147799039-147799061 CAGGGTGCTGCCCTGTTATATGG + Intergenic
917374342 1:174332991-174333013 AAGGATGAAATCCTGTTATTTGG + Intronic
917908314 1:179612632-179612654 CAGGATGATGTACTCTTAAATGG - Intronic
918074262 1:181158643-181158665 CACAATTATGTCCTGTTCTGTGG + Intergenic
918093235 1:181315208-181315230 CAGTATGAAGTCCCGTTAGGGGG + Intergenic
919472281 1:197994642-197994664 CAGGTGGATGTTCTGGTATGAGG + Intergenic
919750339 1:201033992-201034014 CAGGAGGATGACCTGTGGTGAGG + Intergenic
1066223230 10:33356397-33356419 CAGGATGCTATGATGTTATGTGG - Intergenic
1066391363 10:34979668-34979690 CAGGTTGATGCCCTGGTTTGAGG + Intergenic
1071041201 10:81309816-81309838 CAGGATGATGTCATTTGATGGGG - Intergenic
1071790065 10:88943935-88943957 CACAATGATGTGCTGTCATGAGG + Intronic
1071919825 10:90336913-90336935 CAGGATGAAATCCTGATATGTGG + Intergenic
1072174352 10:92902179-92902201 CCTGATGATGTCCTTTGATGTGG + Intronic
1072231573 10:93418129-93418151 CAAGATGAAGTCTTGTTAAGTGG + Intronic
1073564923 10:104526750-104526772 CAGGATGAGCCCATGTTATGGGG + Intergenic
1074993782 10:118737468-118737490 CAAAATGTTGTCTTGTTATGGGG - Intronic
1076492417 10:130871610-130871632 CAGGATGACTTCCTGGGATGTGG - Intergenic
1080414447 11:32056173-32056195 CAGGATGCTCTCCAGATATGGGG - Intronic
1085498598 11:76996109-76996131 AAGGATGATGGCCTGGTTTGTGG - Intronic
1088053973 11:105553152-105553174 CAGGTTGATGGTCTGTTATCAGG + Intergenic
1089932746 11:122330458-122330480 CATGATCATGGCCTGCTATGGGG + Intergenic
1092090379 12:5798970-5798992 CAGAATGATGTCCTGTTTTCTGG - Intronic
1097022741 12:56032350-56032372 AAGGATAATGTGCAGTTATGGGG - Intronic
1104596134 12:130120934-130120956 CTGGATGATATTCTGTTGTGTGG - Intergenic
1107164017 13:37264808-37264830 AAGGATGATGCCCTGAAATGTGG - Intergenic
1109732093 13:66426018-66426040 CATCATGACGTCATGTTATGTGG + Intronic
1110131455 13:72016768-72016790 CAGTATGATGTGCTGATATTTGG + Intergenic
1111833048 13:93354223-93354245 CAGGATGATGTACTGATCGGTGG + Intronic
1112240355 13:97675330-97675352 CTGGATGATGGGCTGATATGAGG - Intergenic
1113242611 13:108355155-108355177 CAGGATGATGTGCTGCTGTAAGG + Intergenic
1116084174 14:40214328-40214350 CAGCATGGTGTGCAGTTATGTGG + Intergenic
1116581748 14:46651415-46651437 CAAGATGTTGTCCTGTGCTGGGG - Exonic
1118910532 14:70058605-70058627 CAGGAAGATGTCCTTAAATGGGG + Intronic
1122823540 14:104358981-104359003 CAGGATGACCTGCTGTTCTGAGG + Intergenic
1130430615 15:83843347-83843369 CAGGATGCTGGCATGTTATCAGG + Intronic
1133525438 16:6600764-6600786 CAAGATTATATCCTTTTATGTGG + Intronic
1134248406 16:12557030-12557052 CAAGATGAGGTCTTGCTATGTGG + Intronic
1134250000 16:12567789-12567811 CAGCAGGAAGTCCTGTGATGTGG - Intronic
1139138301 16:64232019-64232041 CAGGAGGGAGTCCTGTGATGAGG + Intergenic
1152307335 17:79529005-79529027 GAGGCTGCTGTGCTGTTATGTGG - Intergenic
1163218335 19:15897021-15897043 CTGGACTATTTCCTGTTATGAGG - Intronic
1163649956 19:18511575-18511597 CAGACTGATGTCCTGTGGTGTGG - Intronic
1167710872 19:51109690-51109712 CATCATGGTTTCCTGTTATGGGG - Intergenic
925497222 2:4465635-4465657 CAGGATAATCTCCTGTTTTAAGG - Intergenic
927291497 2:21408947-21408969 CAGCATCATGTCCGGGTATGAGG + Intergenic
928424953 2:31170246-31170268 CTGGAAGATGTCCTGGTGTGGGG + Intergenic
929722018 2:44379239-44379261 AAGTATGAGGTACTGTTATGTGG - Intronic
930564189 2:52999078-52999100 CTTGATGATGGCCTGTTAAGGGG + Intergenic
932231926 2:70089881-70089903 CAGGATTATTTCCTGGTATAGGG - Intergenic
932760827 2:74438229-74438251 CAGGATGATTCCCAGGTATGTGG - Intronic
935990209 2:108712579-108712601 CAAGATGTTGTCCTGTGCTGGGG - Intergenic
938946874 2:136220465-136220487 AAGGAATATGTCCTGTTCTGTGG - Intergenic
939784923 2:146497505-146497527 CAGTAAGATGTCATGTTGTGAGG - Intergenic
943867013 2:192938164-192938186 CAAGATGAAGTCCTGGAATGAGG + Intergenic
944546309 2:200802459-200802481 CAGGATGAAGTCTTATTCTGTGG + Intergenic
945159708 2:206876987-206877009 CAGCATGACGCACTGTTATGAGG + Intergenic
947076880 2:226354702-226354724 CAGGGAGATTTCCTGTTGTGGGG - Intergenic
947536515 2:230943252-230943274 CAGGATGCTGTCCTGCTAACAGG - Intronic
1169571693 20:6913290-6913312 CAGGATAATGTCCTCATTTGGGG + Intergenic
1170956235 20:20982343-20982365 CACATTGATTTCCTGTTATGTGG - Intergenic
1173994245 20:47325567-47325589 AAGGAGAATGTCCTGTTCTGGGG - Intronic
1177432212 21:21004881-21004903 CAAGGTGATGTCCTGGTAAGAGG - Intronic
1179924376 21:44525978-44526000 CACCATGATGACCTGTAATGCGG - Intronic
1182426123 22:30273726-30273748 CAGGATCCTGTCCTGAGATGAGG + Intergenic
1185223824 22:49642118-49642140 CAGTAGGCTGTCCTGTGATGGGG - Intronic
952062188 3:29524270-29524292 CAGCATGATTTCATGTTATGGGG - Intronic
955150042 3:56357921-56357943 AAGGATGATGTCGTTTGATGTGG - Intronic
955321911 3:57980632-57980654 CAGGATGATTTGCTCTGATGGGG + Intergenic
958778446 3:98513104-98513126 CAGGATGATGGCATGTAATTTGG + Intronic
961129084 3:124448658-124448680 CTGGATCATATCCTGGTATGTGG - Intronic
961344476 3:126254582-126254604 AAGGATGCTGTCTTCTTATGGGG - Intergenic
961953087 3:130771040-130771062 CAGGATAGTGTCCTTGTATGGGG - Intergenic
962175389 3:133148596-133148618 CATGATGAAGTCCTGTTAATAGG - Intronic
964799753 3:160543172-160543194 CAGGATGATTTCCTAGTATATGG + Intronic
965129656 3:164680735-164680757 GAGGATGATGTACTGTGCTGGGG + Intergenic
965719079 3:171641465-171641487 CTGGATGATGTACTGGAATGTGG - Intronic
966584160 3:181603008-181603030 GGGGATCATGACCTGTTATGGGG + Intergenic
967660813 3:192107455-192107477 AAGGATAATGTCATGTTACGAGG + Intergenic
973092163 4:46150194-46150216 AAGGGTGAAGTCCTGTTAAGAGG + Intergenic
975921192 4:79391586-79391608 CAGGATAATGTCATATTAAGTGG - Intergenic
976101630 4:81570241-81570263 AAGGATGATATCCTGTTAAAAGG + Intronic
976320667 4:83710889-83710911 CATGATTATGTCACGTTATGTGG - Intergenic
977145960 4:93440076-93440098 CAGGAGAAGGTCCTGTTATGAGG + Intronic
978732254 4:112042018-112042040 CAAGATGATCTCATTTTATGTGG + Intergenic
982056796 4:151558506-151558528 CAGGATGTTGCTCTGTTATCAGG - Intronic
982721241 4:158862227-158862249 CAGGATGAGGTGCTTTTCTGTGG - Intronic
990077992 5:51874462-51874484 CAGGATGATGTTGTGGTAAGAGG + Intergenic
990143709 5:52734625-52734647 CATGAAGATGTGCTTTTATGAGG + Intergenic
992874293 5:81037510-81037532 CATGATGATGTCCCTTTGTGTGG + Intronic
994743279 5:103647505-103647527 CAGGATGAAGTCATGGGATGAGG - Intergenic
997853781 5:137355576-137355598 CAGGATGAGGGCTTGGTATGGGG + Intronic
1001074648 5:168616651-168616673 CAAGATGTTGTCCTGTGCTGGGG + Intergenic
1001929450 5:175662409-175662431 CAGGATAATTTTTTGTTATGAGG - Intronic
1002854536 6:1025691-1025713 CAGGGTGATGTCCTGGGATGTGG + Intergenic
1005354151 6:24966622-24966644 CATGATGAAGTCATGTTATGTGG + Intronic
1005894227 6:30164102-30164124 CAGGATGATGTCCTGTTATGAGG + Intronic
1011367195 6:86595921-86595943 CAGGATCCTGGCCTGTGATGAGG - Intergenic
1014014911 6:116518917-116518939 CAGGATGAGAACCTGTTAAGTGG - Exonic
1014167653 6:118244079-118244101 CAGGCTTTTGTCCTGATATGGGG + Intronic
1016366362 6:143322783-143322805 CAGAATGAATTCCTGTAATGAGG - Intronic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1017582609 6:155882685-155882707 CTGGCTGATTTCCTGTTTTGAGG - Intergenic
1021558903 7:21949034-21949056 CAGCACGATTTTCTGTTATGTGG - Intergenic
1026594911 7:71726405-71726427 CAGGATAAAGTCCTGGTGTGTGG + Intergenic
1028256877 7:88610122-88610144 CGGTATGATCTCCTGTTAAGGGG + Intergenic
1029880833 7:103807890-103807912 TGGGATGAGGGCCTGTTATGGGG - Intronic
1030775499 7:113529927-113529949 CAGCATTGTGTCCTGTTTTGGGG + Intergenic
1030851941 7:114498809-114498831 CAGGATGATTTCATGTTGGGTGG + Intronic
1033168361 7:139061420-139061442 AAGGATGGTGTCTTGTTATTTGG - Intronic
1034116535 7:148588825-148588847 CAGGATGAAGTCCTTCAATGGGG + Intergenic
1034495940 7:151422244-151422266 CACGCTGAACTCCTGTTATGGGG + Intergenic
1038519069 8:28213962-28213984 CAGGCTGCTGTCTTGTTATGTGG - Intergenic
1039241867 8:35566155-35566177 CAAGATGATTTTCTGTTACGTGG + Intronic
1046679130 8:117148973-117148995 CAGGGTGATGTCCTGGGATGAGG - Intronic
1047055695 8:121162281-121162303 CAGGATGATCTCCTCATATCAGG + Intergenic
1049297830 8:141852541-141852563 CAGGAGGCTGTGCTGTTAGGAGG + Intergenic
1050768284 9:9163758-9163780 GAGGATGCTGTCAAGTTATGAGG - Intronic
1051510427 9:17871571-17871593 CTGGATAATGACCTGTTAAGTGG - Intergenic
1053444734 9:38143346-38143368 CGGGATGCTGTTCTGTTGTGGGG + Intergenic
1055189730 9:73503054-73503076 CAGGATAATAGCCTGTGATGAGG + Intergenic
1055402281 9:75936938-75936960 CAGAATGATGTCGTGTTAGCAGG + Intronic
1059860051 9:118449739-118449761 CATGATAATTTCCTGTTATTAGG + Intergenic
1061523121 9:131133704-131133726 CAGCATGTTCTACTGTTATGAGG + Intronic
1062348570 9:136127424-136127446 CAGGATTATGTCCTTTTCTGGGG + Intergenic
1062411895 9:136429914-136429936 CAGGATGAGGGGCTGTTAGGTGG + Intronic
1185661355 X:1731383-1731405 CAGGATGATCTCATGTTGAGAGG - Intergenic
1187716227 X:22105036-22105058 CTGGAAAATGTGCTGTTATGTGG + Intronic
1187823487 X:23312405-23312427 CAGTGTGCTTTCCTGTTATGTGG - Intergenic
1188020420 X:25151147-25151169 CTCCATGATGTCCTGGTATGTGG + Intergenic
1189029966 X:37440381-37440403 GAGGCTGATTTCCTGTTATCTGG + Intronic
1194538219 X:95134516-95134538 CAGGATAATAACCTTTTATGTGG - Intergenic
1195222947 X:102763693-102763715 CACGATTATGTTCTGTTATATGG + Intergenic
1195287472 X:103398940-103398962 CATGATTATGTTCTGTTATATGG + Intergenic
1199308350 X:146293354-146293376 TATAATGATGTCCTGTTTTGGGG + Intergenic
1200171895 X:154083035-154083057 CTGGATGATATCCTACTATGTGG - Intronic
1200222801 X:154399912-154399934 CAAGATGTTGTCCTGTGCTGGGG + Exonic
1200755879 Y:6989553-6989575 CTGGATGATTTCTTTTTATGAGG - Intronic