ID: 1005895149

View in Genome Browser
Species Human (GRCh38)
Location 6:30171770-30171792
Sequence ACCACAGATGTTCCTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005895149_1005895153 17 Left 1005895149 6:30171770-30171792 CCTGCTCTAGGAACATCTGTGGT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1005895153 6:30171810-30171832 GTCTGCGCGCTCCTCCCTCTAGG 0: 1
1: 0
2: 2
3: 12
4: 176
1005895149_1005895155 19 Left 1005895149 6:30171770-30171792 CCTGCTCTAGGAACATCTGTGGT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1005895155 6:30171812-30171834 CTGCGCGCTCCTCCCTCTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 90
1005895149_1005895154 18 Left 1005895149 6:30171770-30171792 CCTGCTCTAGGAACATCTGTGGT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1005895154 6:30171811-30171833 TCTGCGCGCTCCTCCCTCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005895149 Original CRISPR ACCACAGATGTTCCTAGAGC AGG (reversed) Intronic
900858642 1:5207057-5207079 AACACAGATGTTCCAAACGCTGG - Intergenic
902393578 1:16120049-16120071 ACCATAGATGCTGCTAGAACAGG - Intergenic
904840802 1:33370692-33370714 ACCACAGACGTTCCTGAAGGAGG - Intronic
905288854 1:36907807-36907829 ACCACAGAGGTTCAGAGAGTGGG + Intronic
905344056 1:37299469-37299491 AGCCCAGATGCTCCTGGAGCAGG - Intergenic
907277144 1:53323060-53323082 AGCACAGAACTTCCTAGAGGAGG + Intronic
908743319 1:67350981-67351003 ACCACAGTCATTCCTAGAACCGG + Exonic
915008656 1:152664254-152664276 ACCACAGCAGCTCCCAGAGCTGG - Exonic
915009940 1:152676164-152676186 ACCACAGCAGCTCCCAGAGCTGG - Exonic
920537373 1:206747221-206747243 ACAACAGATGATCCTGGAGAAGG + Intergenic
921938725 1:220818124-220818146 ACCACAGATGTTCTTGGAATTGG + Exonic
922084344 1:222331854-222331876 AGAACAAATGTTCATAGAGCTGG - Intergenic
924417905 1:243878014-243878036 AGCACAGATTTTCACAGAGCAGG - Intergenic
1063216235 10:3928236-3928258 ACCACCCATCTTCATAGAGCTGG + Intergenic
1063250464 10:4268384-4268406 ATCACAGCTGTACCTAGACCCGG + Intergenic
1063883458 10:10553878-10553900 ACCACAGCTCCTCCTAGGGCTGG - Intergenic
1064269198 10:13849808-13849830 ACCACAGAAGTTGCTAAGGCTGG + Intronic
1067917697 10:50418382-50418404 ACCTCAGAGGCTCCAAGAGCGGG + Intronic
1070487460 10:76944241-76944263 ACCACACATTTTCCTATAGGAGG - Intronic
1072718266 10:97765705-97765727 ATGCCAGATGTACCTAGAGCAGG - Intergenic
1076721078 10:132393552-132393574 ACCACAGATTTCTCCAGAGCTGG - Intergenic
1078270742 11:9792524-9792546 ACCACAGGTGTTCCTAAACAAGG + Intronic
1084704821 11:70810083-70810105 ACCCCAGGAGTTCCTGGAGCAGG + Intronic
1086768941 11:90736612-90736634 ATCATAGATGTTTCTAGAACGGG + Intergenic
1087164809 11:94991156-94991178 AACACTGATATTTCTAGAGCTGG - Intronic
1090243261 11:125198649-125198671 ACCACCGATTGTCTTAGAGCAGG - Intronic
1091073841 11:132595375-132595397 CCCACAGATTTTCATACAGCAGG - Intronic
1098539703 12:71640503-71640525 ACCACTGGTGGTCCCAGAGCAGG - Intronic
1099864989 12:88268937-88268959 AGGACAGAGGCTCCTAGAGCAGG - Intergenic
1100741381 12:97597159-97597181 TCCACAGCTGCTGCTAGAGCTGG + Intergenic
1109194559 13:59363814-59363836 ACCACAGAAGTTCTCAGAGAAGG + Intergenic
1110642023 13:77836318-77836340 AATACAGATGTTCCTAGTGGGGG + Intergenic
1118150506 14:63184153-63184175 CCCACAGATCTTCACAGAGCTGG + Intergenic
1125173770 15:36796637-36796659 ACCTCAGATGTTCATACATCGGG + Intronic
1127702126 15:61511897-61511919 ACCACTGTTGTCTCTAGAGCAGG - Intergenic
1128700365 15:69799522-69799544 GCCACAGCTGTGCCTGGAGCTGG - Intergenic
1129893262 15:79086020-79086042 CCCCCAAATGTTCCTAGAGTTGG - Intronic
1130873062 15:87987095-87987117 ACCACAGATGTTGATTCAGCGGG - Intronic
1141201041 16:81897869-81897891 ACTGCAGATGTCCCTTGAGCTGG + Intronic
1142575984 17:908006-908028 ACCACAGGTGTCTCTAGAGAGGG - Intronic
1143432190 17:6895326-6895348 CCAATTGATGTTCCTAGAGCGGG + Intronic
1145013929 17:19384891-19384913 ACCACAGAGTTGCCTGGAGCAGG + Intronic
1149474872 17:56952165-56952187 ACCACTGATGATCATAGAGCTGG + Intronic
1150435448 17:65150669-65150691 AACACAGCAGTGCCTAGAGCTGG - Intronic
1152823226 17:82447722-82447744 ACCACAGCTGTTCCTACAGTGGG - Intronic
1153020518 18:624534-624556 ATCACAGTTGTTCCCAGATCGGG + Intronic
1156208471 18:34912049-34912071 GAAACAGATGTTCCTAGAGAGGG - Intergenic
1156357617 18:36355857-36355879 ACCACAAATGTTCCTAGGAAAGG - Intronic
1157803978 18:50644436-50644458 TCCTCAGGAGTTCCTAGAGCAGG + Intronic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161330515 19:3684710-3684732 ACCACAGACGCACCCAGAGCGGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161515309 19:4693096-4693118 ACCACAGATGTCCCTAGATGTGG - Intronic
1162297284 19:9821924-9821946 ACAGCAGATCTTCCTACAGCAGG + Intronic
1162897255 19:13772368-13772390 ACCACACTTGTTCCTAGTGCAGG + Exonic
1163207446 19:15814034-15814056 GCCACAGACATCCCTAGAGCAGG + Intergenic
925013612 2:504656-504678 ACCACAGATTGTCCTAGATAGGG - Intergenic
925656273 2:6152894-6152916 ACCACAGATGTGTCTGCAGCTGG + Intergenic
928488840 2:31759804-31759826 AGCACAAATGTTCCCAGGGCAGG - Intergenic
928662866 2:33521222-33521244 ACCATAGATGTGCCAGGAGCTGG + Intronic
932199808 2:69815596-69815618 ATCACAGATCATTCTAGAGCAGG + Intronic
932713970 2:74088193-74088215 TCCACAGATCTTGCTTGAGCTGG + Intronic
942983908 2:182116344-182116366 ACAATAGATGTTCTAAGAGCAGG + Intronic
947744627 2:232501231-232501253 ACCACAGATGTGCCAGGGGCAGG - Intergenic
1173761044 20:45560940-45560962 ACCCCAGGTGGTCCTAAAGCAGG + Intronic
1175661594 20:60817648-60817670 ACTGCAGATGTTGCAAGAGCAGG - Intergenic
1175788236 20:61725216-61725238 GCCACAGATGTCCCTGAAGCAGG - Intronic
1179969499 21:44826207-44826229 ACCAGTGATGTTCCTGGAGTTGG - Intergenic
1181507834 22:23373628-23373650 ACCAAAGATGGTCACAGAGCTGG + Intergenic
1182857151 22:33527835-33527857 ACCACATCTGCTCCTAGAGCAGG + Intronic
1183280347 22:36928947-36928969 TCCGAGGATGTTCCTAGAGCCGG + Intronic
950036153 3:9887340-9887362 ATCACAGATGGTTCTAGACCAGG + Intergenic
952412359 3:33061077-33061099 AACACCGATGTTTCTAGAGCAGG + Intronic
956744850 3:72303226-72303248 ACCACACATTTTCCTGGAGAGGG + Intergenic
959765250 3:110019014-110019036 ACCACAGATGTATCTAGAAATGG - Intergenic
962984040 3:140518267-140518289 ACCACAGAAGTTGCTACAGGTGG - Intronic
963116707 3:141736506-141736528 ACCACACATCTGCCTAGAGATGG - Intergenic
964665549 3:159168041-159168063 GCCACAGATGGTCCTAGAATTGG - Intronic
965938836 3:174150318-174150340 ACCACAAATATTTCTAGTGCAGG + Intronic
966864411 3:184249262-184249284 AACACAGATGTTCCCAGCGCAGG - Intronic
966953025 3:184841558-184841580 AGGACAGATGTTCCTAAAGGTGG + Intronic
968567021 4:1318383-1318405 TCCACAGAAGTGCGTAGAGCAGG + Intronic
968659575 4:1793544-1793566 ACCACAGAGGTCCCTGCAGCGGG + Intronic
970199551 4:13589546-13589568 ACCACATATTTACCTAAAGCAGG + Intronic
972859259 4:43147093-43147115 ACCACGGATGTTAATAGAGCTGG + Intergenic
973287992 4:48440934-48440956 ACCATAGATTTTTGTAGAGCAGG - Intergenic
982103688 4:151993074-151993096 ACCACAGTTATGCCTATAGCTGG + Intergenic
985942798 5:3151928-3151950 CCCTCAGATGTTCCAAGATCAGG + Intergenic
985945689 5:3180997-3181019 GCCACAGGTGATCCTCGAGCAGG - Intergenic
992039772 5:72817958-72817980 ACCGTAGTTGTTCCTAGAGAAGG + Intronic
997658882 5:135575202-135575224 ACCACAGATTGTCCCAGGGCTGG + Intronic
999231457 5:150064618-150064640 GCCACAGAGGCTCCTAGAGATGG - Intronic
1001416415 5:171547592-171547614 ACCATTGATCGTCCTAGAGCTGG - Intergenic
1001936728 5:175710676-175710698 ACCACAGATGTTCCTCCTCCAGG - Intergenic
1005895149 6:30171770-30171792 ACCACAGATGTTCCTAGAGCAGG - Intronic
1008391832 6:50960963-50960985 AGCACAGAGATTCCCAGAGCTGG + Intergenic
1017769878 6:157636705-157636727 AGCAAAGCTGTTCCTAGCGCAGG + Intronic
1019706754 7:2500440-2500462 ACCACTGGAGTTCCCAGAGCGGG - Intergenic
1019744041 7:2689537-2689559 ACCCCAGCTGCTCCTGGAGCAGG - Intronic
1023507483 7:40915389-40915411 ACCTCAAATGTTCCTAAAGGAGG + Intergenic
1023521285 7:41052550-41052572 ACCACAGCTGTCCCTGGAACTGG - Intergenic
1029626130 7:101721328-101721350 ACCACAGAAGGTTCTAGAACAGG - Intergenic
1031650644 7:124285444-124285466 AACACATATGTTGCTAGAACTGG + Intergenic
1033121135 7:138667708-138667730 GCCACAGATGTTTCCATAGCTGG + Intronic
1033846590 7:145440554-145440576 ACCCCAGATGTTCTTTCAGCTGG + Intergenic
1037652103 8:20848194-20848216 ACCACAGAAGTTCTTGGAGTTGG - Intergenic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1042982387 8:74544902-74544924 AGCACAGCTGTTCCTAGTGGTGG - Intergenic
1045250962 8:100483235-100483257 ACCCCAGATGCTCCTAGAGGTGG - Intergenic
1047190438 8:122674407-122674429 ACAACAGATGGTCCTTCAGCAGG - Intergenic
1048678174 8:136808483-136808505 AACACAGACATTCCTAAAGCTGG - Intergenic
1053024789 9:34720517-34720539 ACCACAGAGGAGCCAAGAGCTGG - Intergenic
1053260530 9:36659656-36659678 ACCCCAGATGTACACAGAGCCGG - Intronic
1055111725 9:72566536-72566558 ACCACAGAGGTTCAGAGAACAGG + Intronic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1057724123 9:97556206-97556228 AGCCCAGCTGTTCCTAGTGCCGG + Intronic
1058822256 9:108743630-108743652 ACCACAGATGTGACTACAGGGGG + Intergenic
1059422745 9:114202560-114202582 ACCACAGAAGCTCTTCGAGCAGG - Intronic
1060586884 9:124792222-124792244 AACACACATGTGCCTAGATCAGG - Intronic
1060932327 9:127496975-127496997 ACCATAGCTGTTGCTAGTGCTGG + Intronic
1189519213 X:41748364-41748386 ATCACTGATGATCATAGAGCTGG + Intronic
1192016619 X:67338497-67338519 ACCTCTGAAGTTCCAAGAGCAGG - Intergenic
1193018913 X:76768881-76768903 ACCACATAGGTATCTAGAGCAGG - Intergenic
1195001029 X:100643560-100643582 ACCACTGATTTTCCAAGAGATGG + Intergenic
1199572749 X:149284688-149284710 AGCAGAAATCTTCCTAGAGCAGG + Intergenic
1200002585 X:153069687-153069709 CCCACAGATGTTCCCAGGGCGGG + Intergenic
1200005139 X:153080323-153080345 CCCACAGATGTTCCCAGGGCGGG - Intergenic