ID: 1005911586

View in Genome Browser
Species Human (GRCh38)
Location 6:30314765-30314787
Sequence TGGACATATACCTATGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005911586_1005911589 -2 Left 1005911586 6:30314765-30314787 CCAACTCCATAGGTATATGTCCA No data
Right 1005911589 6:30314786-30314808 CATGAAGCTAGCCCTGCCTCAGG No data
1005911586_1005911593 18 Left 1005911586 6:30314765-30314787 CCAACTCCATAGGTATATGTCCA No data
Right 1005911593 6:30314806-30314828 AGGCATTCACCTCTGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005911586 Original CRISPR TGGACATATACCTATGGAGT TGG (reversed) Intergenic
No off target data available for this crispr