ID: 1005912900

View in Genome Browser
Species Human (GRCh38)
Location 6:30326623-30326645
Sequence TCCAGCGCCCTGCGGGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005912893_1005912900 -2 Left 1005912893 6:30326602-30326624 CCTCGCCGGCCGGGGCGCCAGTC 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1005912900 6:30326623-30326645 TCCAGCGCCCTGCGGGCAATGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1005912894_1005912900 -7 Left 1005912894 6:30326607-30326629 CCGGCCGGGGCGCCAGTCCAGCG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1005912900 6:30326623-30326645 TCCAGCGCCCTGCGGGCAATGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1005912887_1005912900 19 Left 1005912887 6:30326581-30326603 CCTGGAGCCTGGACTAGACAGCC 0: 1
1: 0
2: 2
3: 20
4: 190
Right 1005912900 6:30326623-30326645 TCCAGCGCCCTGCGGGCAATGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1005912888_1005912900 12 Left 1005912888 6:30326588-30326610 CCTGGACTAGACAGCCTCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1005912900 6:30326623-30326645 TCCAGCGCCCTGCGGGCAATGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1005912886_1005912900 25 Left 1005912886 6:30326575-30326597 CCGGGGCCTGGAGCCTGGACTAG 0: 1
1: 0
2: 0
3: 33
4: 296
Right 1005912900 6:30326623-30326645 TCCAGCGCCCTGCGGGCAATGGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005912900 Original CRISPR TCCAGCGCCCTGCGGGCAAT GGG Intronic
910730331 1:90388550-90388572 TCCAGCTCCCTGAAGGGAATGGG - Intergenic
920534466 1:206728725-206728747 TCCACCTCCCTGCGGGCCTTGGG - Exonic
1066681719 10:37941454-37941476 TCCAGAGCTCTGGGGTCAATAGG - Intergenic
1072418935 10:95273215-95273237 GCCAGAGCCCTGTGGGCACTGGG - Intronic
1072801349 10:98394370-98394392 TCCATCGCCCTGGGGGAATTTGG + Intronic
1077030045 11:461408-461430 TCCATCTCCCTGGGGGCAGTGGG + Intronic
1077052721 11:575045-575067 TCTAGCGCCCTTGGGGGAATGGG - Intergenic
1087080846 11:94169675-94169697 TCCAGCCCCCTGTGGGCATGCGG - Intronic
1087943873 11:104134986-104135008 TCCAGTGCCCTGAGGCCAGTGGG + Intronic
1090799146 11:130159902-130159924 CCCCGCGCCCTGCGGGCCATGGG + Exonic
1091823915 12:3495292-3495314 TCTAGCGTCCTGTAGGCAATAGG - Intronic
1107409637 13:40146651-40146673 TGCAGCACCCTGAGGGCAAACGG - Intergenic
1113961826 13:114130559-114130581 TTCACCGGCCTGCGGGCACTCGG - Intronic
1122249028 14:100425157-100425179 TCCTGAGCCCTGCAGGCCATGGG - Intronic
1128581960 15:68817331-68817353 TGCAGCGCCCTGCAGGCTAGGGG - Intronic
1132945149 16:2528280-2528302 TGCAGCGGCCTGCGGGCAGCCGG - Exonic
1141391240 16:83666537-83666559 TGCAGGGCCCTGTGGGCCATGGG - Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1143830379 17:9645892-9645914 TCCAGCTCCCCGCCGGCGATGGG + Exonic
1145241410 17:21242785-21242807 TCCAGGGCCCTGCCTGCACTGGG + Exonic
1152762755 17:82117832-82117854 GCCAACGTCCTGGGGGCAATTGG + Intronic
1157383999 18:47247301-47247323 TCCAGCGCCTTCCGGCCAGTGGG - Intronic
1157533482 18:48441609-48441631 TCCAGGTCCCTGGGGGCAAAAGG + Intergenic
1159943189 18:74424794-74424816 TCCTGAGCCCTGCGGGCACACGG + Intergenic
1161321066 19:3641801-3641823 TCCTGCGGCCTGCAGGCAATGGG + Exonic
1162775212 19:12975178-12975200 TCCAGGGCCCTTCGAGCAAGGGG - Intergenic
1163644136 19:18478786-18478808 GCCTGCGCCCTGCGGTCACTTGG + Intronic
1165432844 19:35782269-35782291 TCCATCCACCTGCGGGCACTTGG + Intronic
1166591536 19:44003529-44003551 TCCAGCGTCCTGCAGGGATTAGG - Intronic
925639853 2:5976908-5976930 TCAAGCACCCTGAGGGCATTAGG - Intergenic
927653560 2:24927177-24927199 CCCTGCGGCCTGCGGGGAATAGG + Intergenic
928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG + Exonic
937056668 2:118943432-118943454 TGCAGTGCCCTGCTGGAAATAGG - Intronic
946225700 2:218263077-218263099 TCCAGCCCCCTGGGAGCATTCGG + Exonic
947938144 2:234025158-234025180 TGCAGCTCCCTGAAGGCAATTGG - Intergenic
1169745013 20:8934925-8934947 TCCAGGCCCCTGTGGGCTATAGG + Intronic
1179875907 21:44267320-44267342 CCCAGCCCCCAGCGGGCCATCGG - Intergenic
1181745291 22:24952006-24952028 TCCAGCACCCAGCATGCAATAGG + Intergenic
1183219955 22:36506264-36506286 TCCAGCGCGCTGCAGGAAGTAGG + Exonic
1185221928 22:49633321-49633343 CTCAGCGCCCTGTGGGCAGTGGG - Intronic
949724373 3:7026262-7026284 TCCAGCACCCTGTGGGCACTAGG + Intronic
953970124 3:47340685-47340707 TCCAGCTCCCTTGGGGCAACTGG + Intronic
954290981 3:49649920-49649942 TCCAGAGCCCTGGGGGCAGGAGG + Intronic
956761288 3:72447175-72447197 TCACGCGCCGTGCGGCCAATGGG + Intergenic
968123620 3:196143079-196143101 TCCAGCACCCTGATGGCCATGGG - Intergenic
971409737 4:26357731-26357753 ACCAGGGACCTGGGGGCAATGGG - Intronic
978013917 4:103720556-103720578 TCCAGCTGCCTGCTGGGAATGGG - Intergenic
987065364 5:14284942-14284964 TCCAGGGCCCTGGAGGCACTGGG - Intronic
987639947 5:20599840-20599862 TCTAGAGCCCTGGGGCCAATGGG + Intergenic
1001058940 5:168471757-168471779 TCCAGCTTCATGGGGGCAATGGG + Intronic
1001391961 5:171386920-171386942 CCCAGCACCCCGCGGGCATTGGG - Intergenic
1001639430 5:173234574-173234596 TCCCGCGCCCCGCGTCCAATCGG - Intronic
1005912900 6:30326623-30326645 TCCAGCGCCCTGCGGGCAATGGG + Intronic
1021219813 7:17962882-17962904 CCGAGAGCCCTGCGGGCAAGAGG + Intergenic
1030960695 7:115917727-115917749 CCCTCCGCCCTGCAGGCAATAGG - Intergenic
1034676252 7:152894622-152894644 CCCAGCGCTCTGCAGGCAAAGGG - Intergenic
1037665522 8:20966209-20966231 TCCTGAGCCCTGTAGGCAATGGG - Intergenic
1037820042 8:22131044-22131066 TCCAGCACCCTGCGGGAAACAGG + Exonic
1041032699 8:53754472-53754494 TCCAGGGCCCTGGGGGACATGGG - Intronic
1049755617 8:144310136-144310158 CCCAGCGCCCTCTGGGCCATTGG + Intronic
1057890296 9:98864812-98864834 TGCAGAACCCTGCGGGCAGTAGG + Intergenic
1061609897 9:131739582-131739604 CCCCGCGCCCGGCAGGCAATGGG + Intronic
1062556249 9:137114561-137114583 TCCGGGGCCCTGCGGGCTGTGGG + Exonic
1185609603 X:1386651-1386673 TCCAACGTCCTGCGGGGCATGGG - Exonic
1200744595 Y:6892832-6892854 TCCAGAGCTCTGGGGTCAATAGG - Intergenic