ID: 1005913001

View in Genome Browser
Species Human (GRCh38)
Location 6:30327023-30327045
Sequence AGCCTGGGGCCTGCGCTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005912991_1005913001 12 Left 1005912991 6:30326988-30327010 CCGGGAAGGTAGGTGCTGTCCCG 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 185
1005912992_1005913001 -7 Left 1005912992 6:30327007-30327029 CCCGCCGCCGCGCCCGAGCCTGG 0: 1
1: 0
2: 3
3: 39
4: 629
Right 1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 185
1005912994_1005913001 -8 Left 1005912994 6:30327008-30327030 CCGCCGCCGCGCCCGAGCCTGGG 0: 1
1: 0
2: 5
3: 52
4: 593
Right 1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 185
1005912986_1005913001 25 Left 1005912986 6:30326975-30326997 CCCGGACCCGAAGCCGGGAAGGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 185
1005912987_1005913001 24 Left 1005912987 6:30326976-30326998 CCGGACCCGAAGCCGGGAAGGTA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 185
1005912989_1005913001 19 Left 1005912989 6:30326981-30327003 CCCGAAGCCGGGAAGGTAGGTGC 0: 1
1: 0
2: 1
3: 8
4: 180
Right 1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 185
1005912990_1005913001 18 Left 1005912990 6:30326982-30327004 CCGAAGCCGGGAAGGTAGGTGCT 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005913001 Original CRISPR AGCCTGGGGCCTGCGCTCGC CGG Intronic
900097504 1:945970-945992 AGCCTGGGGCTTCCCCTCCCTGG + Intronic
900605242 1:3520939-3520961 AGCATGGGGCCAGAGCTCTCAGG - Intronic
901198048 1:7451329-7451351 AGCCTGGGGGCTGAGCTGCCTGG - Intronic
901490782 1:9595289-9595311 AGCCTGGGGCCAACCCTCTCTGG - Intronic
901595040 1:10378218-10378240 AGCCTGGGGCCCGGGCTCCCTGG - Intronic
901956144 1:12787295-12787317 ACCCCGGGGCCTGTGCTTGCAGG + Intergenic
901979524 1:13023364-13023386 ACCCCGGGGCCTGTGCTTGCAGG + Intronic
902002559 1:13205574-13205596 ACCCCGGGGCCTGTGCTTGCAGG - Intergenic
902021793 1:13351338-13351360 ACCCCGGGGCCTGTGCTTGCAGG - Intergenic
904676495 1:32201980-32202002 TGCCTGGGGCCTGGGCTGGCTGG - Exonic
904795820 1:33055606-33055628 AGCCTGGGGCCTGTGGACACAGG + Intronic
904847385 1:33430648-33430670 AGCCTGGGGCCGAGGCTTGCCGG - Intronic
905278456 1:36834002-36834024 AGACTGGGGCCTGGGCTGACAGG - Intronic
905687994 1:39922483-39922505 AGCCTGGGGCCTGCGACGTCCGG - Intergenic
907200957 1:52726550-52726572 AGCCCGGAGCCGCCGCTCGCCGG + Exonic
914474631 1:148013313-148013335 GGCCGGAGGCCTGCGGTCGCAGG - Intergenic
916717227 1:167455843-167455865 GGCCTGGGGCCTGCCTTCGGTGG + Intronic
918376967 1:183918797-183918819 AGCCTGTGACATGCGCTGGCAGG - Intronic
918558714 1:185838162-185838184 AGCCTGGGGCTTGTGCTGGTGGG - Intronic
919465091 1:197916444-197916466 AGCTTGGCGCCTGCCCCCGCAGG - Intronic
919739959 1:200975404-200975426 ACCCTGGGACCTGGACTCGCGGG - Intronic
922539606 1:226408677-226408699 AGGCGGGGGCCTGCGCTTCCCGG - Intergenic
924754774 1:246931447-246931469 GGCCTAGGCCCGGCGCTCGCGGG + Intronic
1064033913 10:11900344-11900366 AGCCTGGGTCCTGTGGTCCCTGG + Intergenic
1069680775 10:70283830-70283852 AGCAGGGGGCGTGCGCTCCCAGG + Intergenic
1070257305 10:74824378-74824400 AGCCTGGGGCCTCCCCTCCCTGG + Intergenic
1071086580 10:81874385-81874407 AGCCCGGGGTCTGCGTTCCCCGG + Intergenic
1074772581 10:116743059-116743081 GGCCTGGGTCCTGCCCGCGCCGG - Intergenic
1075704955 10:124494952-124494974 GTCCTGGGGCCTGCACTGGCTGG - Intronic
1076347304 10:129788306-129788328 AGCCTGGGTCCTTCGCCAGCTGG - Intergenic
1076982228 11:210746-210768 AGGGTGGGGCCTGGGCTCTCAGG - Intronic
1077413116 11:2412673-2412695 AAGCTGGGTCCTGCCCTCGCAGG - Intronic
1078345546 11:10544770-10544792 AGCCTGGGGGCTGGGCTGCCAGG - Intergenic
1079002236 11:16767615-16767637 AGCCTGAGGCCAGGGCTTGCAGG - Intergenic
1080644228 11:34176451-34176473 AGCCTGGGGCCTGACATGGCAGG + Intronic
1083886818 11:65577072-65577094 AGGCTGGGGCCTGCACCCTCTGG - Intronic
1085485561 11:76860661-76860683 AGCCGGGGGCCTGGGCTTCCTGG - Intergenic
1086457464 11:86973421-86973443 AGCCTGGTGCCTGGGTTTGCAGG + Intergenic
1088713062 11:112525493-112525515 AGCCTGGGGCCTGGTTTCCCAGG - Intergenic
1090749444 11:129733048-129733070 TGCCTGGGGCCTGAGTTTGCTGG - Intergenic
1090761179 11:129838067-129838089 AGCCTGGGGGCTGCACGCGGTGG - Intronic
1091028092 11:132159819-132159841 TGCCTCGGGCCTTAGCTCGCTGG - Intronic
1091393259 12:138729-138751 GGCCCGGGGCCCGCGCTCTCCGG - Exonic
1091980574 12:4860889-4860911 AGACAGGGGACTGCCCTCGCAGG + Intergenic
1096791337 12:54047077-54047099 CACCTGGGCCCTGCGCTGGCGGG - Intronic
1097284308 12:57865587-57865609 AGGCTGGGGCCTGGGCTCTGCGG - Intergenic
1097777848 12:63668717-63668739 GGCTTGGGGCCTGCGCGCACCGG - Intronic
1098983578 12:76985589-76985611 AGCCTGGAGCCTGTGTTTGCAGG + Intergenic
1101178179 12:102179219-102179241 AGCCTGAGGCCTATGCTCTCAGG + Intronic
1101490885 12:105208347-105208369 AGGCTGGGACCTGGGCTCACTGG + Intronic
1102247029 12:111362385-111362407 AGCCTGGGGCCGGAGTTCTCAGG + Exonic
1102537464 12:113591931-113591953 AGCCTGCGGGCTGCGCTGGAAGG - Intergenic
1104649632 12:130522373-130522395 AGACTGGGGCCTGGGCTGGCCGG - Intronic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1112991284 13:105516556-105516578 AGCCTGGGAGCTGTGCTCACTGG + Intergenic
1114239455 14:20852868-20852890 AGCCTGGAGCCTGCACTGGGGGG + Intergenic
1115382480 14:32756389-32756411 AGCCTGGATCCTGGGCTCACAGG + Intronic
1116958206 14:50944697-50944719 AGCCCGGGACCTGGGCTCGGAGG + Exonic
1119189984 14:72674704-72674726 TGCCTGGGGCCTGGGCCCACAGG - Intronic
1119325182 14:73755580-73755602 AGCCTGGGGCCTGGGCGGGTAGG + Intronic
1119689817 14:76662779-76662801 AGCCTGGGTTCTGAGCTCACAGG + Intergenic
1119730351 14:76947323-76947345 TGCCTGGGCCCCGCGCTTGCCGG - Intergenic
1122283494 14:100637943-100637965 AGCCTGGGGCCAGGCCTCGAAGG - Intergenic
1122787777 14:104171846-104171868 CGCCGGGGGCCTGCGCTGCCTGG - Exonic
1122961095 14:105093884-105093906 AGCCTGGACCCTCCGCTCTCCGG - Intergenic
1123012700 14:105357050-105357072 AGCCTGGGGCAGGAGCTCACAGG - Intronic
1127753397 15:62067856-62067878 AGACTGGGACCCGCGCTCGCAGG + Exonic
1127763662 15:62164735-62164757 GGACTGGGACCCGCGCTCGCAGG - Exonic
1128159083 15:65411247-65411269 AGCCTGGGGGCTGCTGCCGCTGG - Exonic
1129111577 15:73340169-73340191 AGCCCTGGGCCTGAGCTCCCAGG + Intronic
1129756754 15:78103425-78103447 ATACTGGGGCCTGGGGTCGCTGG - Intronic
1129803851 15:78438165-78438187 AGCCCCGGGTCTGCGCTCGCGGG - Intronic
1130932319 15:88438318-88438340 GGCCTGGGCCCTGGGCTCACTGG + Intergenic
1132844372 16:1993108-1993130 ACCCTGGGGCCTGCGTTGGTGGG - Exonic
1134797685 16:17056847-17056869 AGCCTGGAGCCTGGGCCTGCAGG + Intergenic
1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG + Exonic
1142253057 16:89001589-89001611 AGCCTGGAGCCTCCACCCGCAGG - Intergenic
1142476839 17:193828-193850 GGCCTGGAGCCTGGGCTCCCTGG - Intergenic
1142586669 17:978899-978921 GGCCTGGCGCCTCTGCTCGCGGG + Intronic
1143109270 17:4544358-4544380 AGCCTGGGCCCCTAGCTCGCAGG - Intronic
1143649798 17:8256441-8256463 GGCCTGGGGCCTCCCCTCCCCGG - Intronic
1144312320 17:14024664-14024686 AGCCTGGGGCAGGCCCTAGCAGG + Intergenic
1144332434 17:14236661-14236683 AGCCTGGGGCAGGCCCTAGCAGG - Exonic
1144758507 17:17694417-17694439 AGGTTGGGGGCTGCCCTCGCTGG - Intronic
1144945616 17:18968135-18968157 GGCCTGGGGCCTGCACTTCCTGG + Intronic
1145026398 17:19471006-19471028 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145276909 17:21437016-21437038 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145314741 17:21722909-21722931 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145713183 17:26994846-26994868 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1148028073 17:44601941-44601963 TGCCGGGTGCCTGCGCTTGCAGG - Intergenic
1149703051 17:58671548-58671570 AGCTTGGGGCCTGAGCTGGGTGG - Intronic
1150461454 17:65356972-65356994 AGCCTGGGGCATGCACTGTCTGG - Intergenic
1150790099 17:68196454-68196476 AGCTCGGGGCGTCCGCTCGCCGG - Intergenic
1152162125 17:78675369-78675391 AGTCGGGGGCCTGCCCTGGCCGG - Exonic
1152231771 17:79117488-79117510 AGGCTGGGGGCTGCCCCCGCAGG + Intronic
1152738500 17:82008890-82008912 GGCCTTGGCCCTGCGCTGGCCGG + Intronic
1152797224 17:82314398-82314420 AGCATGGGAGCTGCGCTGGCTGG + Intergenic
1154214842 18:12408234-12408256 AGCCAGGCCCCTGCGCACGCCGG - Intronic
1155221530 18:23689895-23689917 GGGCTGGGGCCTCCCCTCGCCGG - Exonic
1160576323 18:79856260-79856282 AGCCTGGTGTGTGTGCTCGCGGG + Intergenic
1161001266 19:1912392-1912414 GGCCTCGGGCCCGCGCTCGCTGG + Exonic
1161684497 19:5696216-5696238 TGTCTGGGGCCTGGGCTTGCTGG - Intronic
1162345830 19:10117425-10117447 AGCGTGGGGCCTGCGCAGTCTGG + Intronic
1163368560 19:16889475-16889497 AGCCTGGGGTCTGCCCTGGTGGG - Intronic
1163692574 19:18745521-18745543 AGCTCGGGGCCAGCGCCCGCCGG - Intronic
1166086257 19:40477431-40477453 AGCCTGGGTCCTGCCCCCACAGG + Intronic
1166939409 19:46353685-46353707 AGCCCAGGGCCTGTCCTCGCAGG + Intronic
1168046548 19:53798286-53798308 AGACTGGGGCCTGTGGTTGCTGG - Exonic
1168691551 19:58380665-58380687 GGCCTGGAGCCTCCCCTCGCGGG + Intronic
929565192 2:42979572-42979594 AGCCAGAGGCCTGGTCTCGCTGG - Intergenic
937334425 2:121052724-121052746 AGCTTGGGGGCTGGGCTCACAGG + Intergenic
938392845 2:130918508-130918530 TGGCTGTGGCCTGCGCTCCCCGG - Intronic
938406283 2:131034989-131035011 GGCGGGGCGCCTGCGCTCGCGGG - Intronic
941119103 2:161507825-161507847 GGCCTAGGCCCGGCGCTCGCGGG + Intronic
942061156 2:172229789-172229811 AGCCTGGGACCAGCACTTGCTGG + Intergenic
944329219 2:198445571-198445593 AGCCTGGGGCCTTCCCTCAGGGG - Intronic
944933770 2:204545930-204545952 AGAGTGGGGGCTGCGCCCGCGGG + Intronic
945484429 2:210378153-210378175 AGCATGGGGCCTGCTGTGGCTGG - Intergenic
946230641 2:218289228-218289250 AGCCTGGGTCCTGGGCTAGGAGG + Intronic
948197743 2:236107781-236107803 CGCCTGGGGCCTGCACCTGCCGG + Intronic
948497172 2:238358589-238358611 ATCCTGGGGACTGCCCTCGGGGG - Intronic
948729931 2:239956396-239956418 AGCGTGGGGCCTGAGCACGTGGG + Intronic
948847527 2:240690300-240690322 AGCCTGGGGCCTCCCCTCCTTGG + Intergenic
1168804721 20:665652-665674 ACCCTGGGGGCTGGGCTCCCTGG + Intronic
1172114129 20:32563588-32563610 TGCCTTGGGCCTGGGCTGGCTGG - Intronic
1172501636 20:35432160-35432182 AGCCTGGAGCCTCCCCTCACTGG - Intergenic
1172698035 20:36835674-36835696 GGCCTGGGGCCTGAGCTGGATGG - Intronic
1173868938 20:46330027-46330049 GGCCTGGGGGCTGGGCTGGCTGG + Intergenic
1174404542 20:50294853-50294875 AGCCTGGGGTCTGCACGCGGTGG - Intergenic
1174962445 20:55173832-55173854 AGCCTGGGGCATGCGGTCCATGG + Intergenic
1178741659 21:35207156-35207178 ACCCTGGGGCCCGGGCTCTCTGG + Intronic
1179995664 21:44972934-44972956 AGCTTGGGGCCCGCGGTCACAGG + Intronic
1180152164 21:45954639-45954661 AGCCTGGGGCAGGCGCGCGCTGG + Intergenic
1182296920 22:29315391-29315413 TGCCTCGGGCCTGCCCTCTCCGG - Exonic
1183659439 22:39210068-39210090 TGCCTGGGGCCTGCAGACGCTGG - Intergenic
1183671308 22:39274431-39274453 AGCCTGGAGTCTGCGATAGCAGG - Intergenic
1184412109 22:44331529-44331551 AGCCGGGAGCCGGCGCCCGCGGG + Intergenic
1184796825 22:46737867-46737889 TCCCTGGCGCCTGCGCTCCCAGG + Intronic
950507438 3:13403968-13403990 CCCCTGGGGCCTGCTCTCTCTGG + Intronic
956700771 3:71956678-71956700 ACCCTGGGGCATGCGTTCTCTGG + Intergenic
958923020 3:100127314-100127336 AGCCTGGGCCCTGCTCTCGAGGG - Intronic
961831778 3:129626835-129626857 AGCCTGGGGCCTGGCCTGGGCGG - Intergenic
963066565 3:141269043-141269065 AGGGTGGGGCCTGCACTCTCAGG - Intronic
965519583 3:169659216-169659238 AGCCTGGGAGCTGGGCTAGCCGG + Intronic
966930612 3:184673243-184673265 AGCTTGGGGGCTGCTCTCCCAGG - Intronic
968977145 4:3827891-3827913 AGTCAGGGGCCTGGGCTCCCTGG - Intergenic
968985609 4:3872819-3872841 AGCCTGAGGCCTGGGGTAGCTGG + Intergenic
969212772 4:5700560-5700582 AGCCTGGGTCCTTTGCTCCCTGG - Intronic
969671524 4:8592754-8592776 GGCCGGGGCTCTGCGCTCGCTGG - Exonic
970692028 4:18630909-18630931 GGACTGCGCCCTGCGCTCGCAGG - Intergenic
972765549 4:42150671-42150693 AGCCTGAGGCCTGCGCCCAAGGG - Intronic
974877119 4:67714443-67714465 GGCATGGGGCCTGTGCTCCCAGG - Intergenic
985520588 5:372353-372375 AGCCTGGGCCCTGTGCACCCTGG + Intronic
985620582 5:952768-952790 AGCCCGGGGCCTGTGTTCACTGG - Intergenic
986464502 5:8008092-8008114 AGCCTGGAGCCTGAGTTCACGGG + Intergenic
989576365 5:42992089-42992111 CGCCTGGTGCCCGCGCTTGCCGG + Intergenic
1001453304 5:171842565-171842587 AGTATGGGGGCTGCGCTCCCTGG - Intergenic
1001875086 5:175193214-175193236 AGCCTGGGGCCTGTGGTGGTTGG - Intergenic
1002439314 5:179256135-179256157 AGCCTGGGGCCTCTGCTCTGAGG - Intronic
1004111505 6:12723164-12723186 AGCCTGGGGCTGGCCCTCCCAGG - Intronic
1004198336 6:13525569-13525591 AGCCTGAGGCCAGCACTCCCTGG - Intergenic
1004408606 6:15359511-15359533 TGCCTAGGGCCTGCCCACGCGGG - Intronic
1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG + Intronic
1007218389 6:40259259-40259281 AGCCAGGGGCCTGTTCTGGCTGG - Intergenic
1007635568 6:43297948-43297970 GGCCTGGGGCCAGCTCTCCCAGG - Intronic
1008230878 6:48984012-48984034 AGTGTGGGGCCTGCAATCGCGGG - Intergenic
1018444728 6:163844940-163844962 AGCCTGGGGCTTGAGCTCCTTGG + Intergenic
1018757390 6:166862342-166862364 AGCGCGGGGCCTGCGCCGGCCGG + Exonic
1019343071 7:517589-517611 GGACTGCGGCCGGCGCTCGCGGG - Intronic
1019515858 7:1439930-1439952 AGGCTGGGTCCTGGGCTGGCTGG + Exonic
1019573229 7:1723657-1723679 GGCCTGGGGCTTGGGCTCGTGGG + Intronic
1023984115 7:45085411-45085433 AGGCTGGGGCCTGTCCCCGCAGG - Exonic
1026970514 7:74464895-74464917 ACCCTGGGGCCAGCACTCGGTGG + Intronic
1032475164 7:132206879-132206901 AGCCTGGAGCCTGTCCTCCCTGG - Intronic
1032740003 7:134729511-134729533 AGACTTGGGCCTGCCCTCGGGGG - Intergenic
1034897632 7:154887609-154887631 AGTTTGGGGGCTGCGCTCACAGG + Intronic
1038335125 8:26639948-26639970 AGCCTGGGGACTGTGCTGTCAGG - Intronic
1038963518 8:32548128-32548150 AGCCTGGGCTCGGCGCTCCCGGG - Intronic
1045840903 8:106579529-106579551 AGCCTTGGGACTGAGCTTGCTGG + Intronic
1045971466 8:108083415-108083437 TGCCTGGGGACCGCGCTCGCGGG - Exonic
1048328705 8:133457843-133457865 GGCATGGGGCCTGTGCTCCCAGG - Exonic
1049521787 8:143095128-143095150 GTCATGGGGCCTGCCCTCGCAGG + Intergenic
1051207574 9:14704440-14704462 AGCCTGGGGCCTGCTGTGGTTGG - Intergenic
1051641846 9:19230867-19230889 AGCCTGCGCCGTGCCCTCGCGGG + Intronic
1052898777 9:33772157-33772179 AGCCTGGGGGCTGCGCGCGGTGG - Intronic
1056855725 9:90128118-90128140 AGCCTGTGCCCTCCGCTCCCCGG + Intergenic
1056991822 9:91420552-91420574 AGCCCAGGGCCTGCGCTCTTAGG + Intronic
1057082233 9:92181519-92181541 AGCCTGGGGCTGGCTCCCGCTGG + Intergenic
1057335342 9:94150704-94150726 CACCTGGGGCCTGCCCTCCCAGG - Intergenic
1058954356 9:109931706-109931728 ATCCTGGGGCTTGAGCTCTCTGG + Intronic
1060656631 9:125376606-125376628 AGGCTGGCACCTGGGCTCGCAGG + Intergenic
1060811990 9:126615245-126615267 CGCCTGCCGCCTGCGCTCCCCGG - Intronic
1060831365 9:126719748-126719770 TGCCTGGGGCCTGCCCACTCTGG - Intergenic
1061825488 9:133255975-133255997 GGACTGGGGCCGGCGCTCGTAGG + Exonic
1062153214 9:135032125-135032147 AGCCACTGGCCTGGGCTCGCAGG + Intergenic
1187406697 X:19010682-19010704 AGCCTGGAGCCTAACCTCGCAGG - Exonic
1195135835 X:101906653-101906675 AGCCTGGGACCTGGGCACACAGG - Intronic
1200129049 X:153831038-153831060 AGCCGGGGGCGGGCGCTCGACGG + Intergenic