ID: 1005913360

View in Genome Browser
Species Human (GRCh38)
Location 6:30329727-30329749
Sequence GTCCAGTGGCACAACGGTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005913360_1005913367 3 Left 1005913360 6:30329727-30329749 CCCACACCGTTGTGCCACTGGAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1005913367 6:30329753-30329775 GCTACACAGGAGTACAAGGTGGG 0: 1
1: 0
2: 7
3: 318
4: 3149
1005913360_1005913370 30 Left 1005913360 6:30329727-30329749 CCCACACCGTTGTGCCACTGGAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1005913370 6:30329780-30329802 CAGACACACGATGTCAGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 92
1005913360_1005913368 4 Left 1005913360 6:30329727-30329749 CCCACACCGTTGTGCCACTGGAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1005913368 6:30329754-30329776 CTACACAGGAGTACAAGGTGGGG 0: 1
1: 0
2: 2
3: 22
4: 229
1005913360_1005913365 -1 Left 1005913360 6:30329727-30329749 CCCACACCGTTGTGCCACTGGAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1005913365 6:30329749-30329771 CGATGCTACACAGGAGTACAAGG 0: 1
1: 0
2: 0
3: 3
4: 73
1005913360_1005913369 29 Left 1005913360 6:30329727-30329749 CCCACACCGTTGTGCCACTGGAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1005913369 6:30329779-30329801 GCAGACACACGATGTCAGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 84
1005913360_1005913363 -10 Left 1005913360 6:30329727-30329749 CCCACACCGTTGTGCCACTGGAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1005913363 6:30329740-30329762 GCCACTGGACGATGCTACACAGG 0: 1
1: 0
2: 0
3: 1
4: 70
1005913360_1005913366 2 Left 1005913360 6:30329727-30329749 CCCACACCGTTGTGCCACTGGAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1005913366 6:30329752-30329774 TGCTACACAGGAGTACAAGGTGG 0: 1
1: 0
2: 0
3: 15
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005913360 Original CRISPR GTCCAGTGGCACAACGGTGT GGG (reversed) Exonic
910941851 1:92544734-92544756 GTTCAGTGGCAGAATAGTGTGGG - Intronic
1064545754 10:16448535-16448557 GTCCAGGGGTCCAGCGGTGTGGG - Intronic
1065066258 10:21968559-21968581 GTGCAGTGGCACGACGATCTCGG + Intronic
1077718579 11:4605100-4605122 CTCCATTGGCACAACACTGTGGG + Exonic
1091695111 12:2623155-2623177 GTCTAGTGGGACAAGGGTTTAGG + Intronic
1096199109 12:49668623-49668645 GCCCAGTAGCAGAAAGGTGTGGG - Intronic
1096767274 12:53902204-53902226 GGCAAGGGGCACAATGGTGTGGG - Intergenic
1097735025 12:63173084-63173106 GTGCAGAGGCACAAAGGTTTAGG + Intergenic
1108677200 13:52747307-52747329 GTTCATTGGCACAAGGATGTAGG - Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1123457337 15:20438007-20438029 GTGCAATGGCACAATGTTGTCGG - Intergenic
1123660721 15:22562352-22562374 GTGCAATGGCACAATGTTGTCGG + Intergenic
1124263487 15:28213157-28213179 GTGCAATGGCACAATGTTGTCGG - Intronic
1124314521 15:28656589-28656611 GTGCAATGGCACAATGTTGTCGG + Intergenic
1126671514 15:51119539-51119561 GGCCAATGGCACAACTATGTGGG - Intergenic
1126919357 15:53503639-53503661 GTCCAGTAACATAAGGGTGTGGG - Intergenic
1129292869 15:74581954-74581976 GTCTAGTGGCACAACAGCATTGG + Intronic
1131083238 15:89554440-89554462 GGCCAGTCCCACAACGGTCTGGG + Intergenic
1139249628 16:65482388-65482410 GGCAAGTGACAAAACGGTGTTGG + Intergenic
1141677724 16:85526332-85526354 GGCCAGTGGCACAGCGGCCTGGG - Intergenic
1142331758 16:89458925-89458947 GACCAGGGTCACGACGGTGTGGG - Intronic
1143226815 17:5312198-5312220 GTGCAGTGGCACAACAATCTTGG + Intronic
1145846218 17:28041590-28041612 GGCCAGTGGCAACAAGGTGTGGG - Intergenic
1147947562 17:44088588-44088610 GTGGAGTGGCACTACGGAGTTGG + Exonic
1152565965 17:81100596-81100618 GCCCAGTGGCACAGTGGTCTTGG - Intronic
1156225259 18:35099474-35099496 GTGCAGTGGCACATACGTGTAGG + Intronic
1156552969 18:38037753-38037775 GTGCAGTGGCACGGCGGTCTCGG + Intergenic
1162754296 19:12847900-12847922 GGCCAGAGGCAGAACGCTGTCGG - Exonic
1163436941 19:17301542-17301564 CTCCAGTGGCCCCACGGCGTTGG + Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
929557502 2:42934680-42934702 GTGGAGTGGCACAAAGCTGTTGG - Intergenic
934671679 2:96217767-96217789 GTGCAGGGGCATAAGGGTGTGGG + Intergenic
936952550 2:117992649-117992671 GCCCAGTGTCACAATGGTGATGG - Intronic
1173589966 20:44217033-44217055 GTCCCATGGGACAACGGGGTCGG - Intergenic
1181110569 22:20600504-20600526 GTCCAGTGGCAAAAAGTTGAGGG + Intergenic
949729373 3:7090472-7090494 CTCCAGTGGCATCACTGTGTGGG - Intronic
950788424 3:15454101-15454123 GTCCCATGGCACATCGCTGTGGG - Intronic
953562966 3:44009340-44009362 ATCCAGTGGCTCTACTGTGTTGG + Intergenic
955618528 3:60835655-60835677 GTGCAGTGGCACACAGGTATTGG + Intronic
983267653 4:165524098-165524120 GTGCAGTGGCACAATGATCTCGG - Intergenic
1001596912 5:172904492-172904514 GGGCAGTGGCAGACCGGTGTGGG - Intronic
1005913360 6:30329727-30329749 GTCCAGTGGCACAACGGTGTGGG - Exonic
1007808761 6:44471786-44471808 GTGCAGTTGCAGACCGGTGTTGG + Intergenic
1012482538 6:99683321-99683343 GTACAGTGACACAGCTGTGTAGG + Intergenic
1014666713 6:124246896-124246918 GCCCAGTGGGACACCTGTGTTGG - Intronic
1018443329 6:163833388-163833410 GTACAGTGGCACAACCATGATGG - Intergenic
1019944600 7:4316667-4316689 GTGCAGTGGCACAATGATCTTGG - Intergenic
1019960957 7:4459050-4459072 GTGCAGTGGCACAATGATCTTGG - Intergenic
1021083993 7:16399202-16399224 GTCTAGTGTCACAAATGTGTTGG - Intronic
1021235702 7:18139991-18140013 GTTCTGTGGCACAACGGTTGTGG + Intronic
1023241302 7:38150922-38150944 GTCCAGTGACACATAGTTGTAGG - Intergenic
1028171352 7:87600550-87600572 GTCCAGTGCCACTACGGTTTGGG + Intronic
1029199353 7:98828245-98828267 GTGCAGTGGCACGACGCTTTCGG + Intergenic
1038288159 8:26224966-26224988 GTGCAGTGACATAAAGGTGTGGG - Intergenic
1041251335 8:55937744-55937766 GTGCAGTGGCACAACAATCTTGG + Intronic
1041846512 8:62335373-62335395 GTGCAGTGGCACAATGATCTTGG - Intronic
1047484070 8:125312772-125312794 GTCCAGTGGCAGGATGGGGTGGG + Intronic
1051975308 9:22941557-22941579 GTCCAGGGGCAGAATGGTATGGG - Intergenic
1054262604 9:62882792-62882814 TTCCTGTGGTACAACGCTGTTGG - Intergenic
1189946893 X:46188908-46188930 GTGCAGGGGCACATGGGTGTGGG - Intergenic
1198254951 X:134916203-134916225 GTGCAGTGGCACAATGATATTGG - Intergenic