ID: 1005916681

View in Genome Browser
Species Human (GRCh38)
Location 6:30358056-30358078
Sequence GGCAGCGCGTGGGGTCCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005916681_1005916685 -3 Left 1005916681 6:30358056-30358078 CCGTCGGGACCCCACGCGCTGCC No data
Right 1005916685 6:30358076-30358098 GCCCCAGTGAAATGAAATCCTGG No data
1005916681_1005916689 6 Left 1005916681 6:30358056-30358078 CCGTCGGGACCCCACGCGCTGCC No data
Right 1005916689 6:30358085-30358107 AAATGAAATCCTGGTGCTTGTGG No data
1005916681_1005916691 20 Left 1005916681 6:30358056-30358078 CCGTCGGGACCCCACGCGCTGCC No data
Right 1005916691 6:30358099-30358121 TGCTTGTGGCGTGCGCTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005916681 Original CRISPR GGCAGCGCGTGGGGTCCCGA CGG (reversed) Intergenic