ID: 1005918767

View in Genome Browser
Species Human (GRCh38)
Location 6:30379577-30379599
Sequence GAGAAATGCCCCATGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005918767_1005918773 17 Left 1005918767 6:30379577-30379599 CCTTTGAGCATGGGGCATTTCTC No data
Right 1005918773 6:30379617-30379639 ACTTAGGGGTCCCAGCAAAATGG No data
1005918767_1005918769 1 Left 1005918767 6:30379577-30379599 CCTTTGAGCATGGGGCATTTCTC No data
Right 1005918769 6:30379601-30379623 TACACCGAGGAACTGAACTTAGG No data
1005918767_1005918770 2 Left 1005918767 6:30379577-30379599 CCTTTGAGCATGGGGCATTTCTC No data
Right 1005918770 6:30379602-30379624 ACACCGAGGAACTGAACTTAGGG No data
1005918767_1005918771 3 Left 1005918767 6:30379577-30379599 CCTTTGAGCATGGGGCATTTCTC No data
Right 1005918771 6:30379603-30379625 CACCGAGGAACTGAACTTAGGGG No data
1005918767_1005918774 20 Left 1005918767 6:30379577-30379599 CCTTTGAGCATGGGGCATTTCTC No data
Right 1005918774 6:30379620-30379642 TAGGGGTCCCAGCAAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005918767 Original CRISPR GAGAAATGCCCCATGCTCAA AGG (reversed) Intergenic
No off target data available for this crispr