ID: 1005918772

View in Genome Browser
Species Human (GRCh38)
Location 6:30379605-30379627
Sequence GACCCCTAAGTTCAGTTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005918772_1005918774 -8 Left 1005918772 6:30379605-30379627 CCGAGGAACTGAACTTAGGGGTC No data
Right 1005918774 6:30379620-30379642 TAGGGGTCCCAGCAAAATGGAGG No data
1005918772_1005918777 5 Left 1005918772 6:30379605-30379627 CCGAGGAACTGAACTTAGGGGTC No data
Right 1005918777 6:30379633-30379655 AAAATGGAGGAGATCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005918772 Original CRISPR GACCCCTAAGTTCAGTTCCT CGG (reversed) Intergenic
No off target data available for this crispr