ID: 1005918774

View in Genome Browser
Species Human (GRCh38)
Location 6:30379620-30379642
Sequence TAGGGGTCCCAGCAAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005918772_1005918774 -8 Left 1005918772 6:30379605-30379627 CCGAGGAACTGAACTTAGGGGTC No data
Right 1005918774 6:30379620-30379642 TAGGGGTCCCAGCAAAATGGAGG No data
1005918767_1005918774 20 Left 1005918767 6:30379577-30379599 CCTTTGAGCATGGGGCATTTCTC No data
Right 1005918774 6:30379620-30379642 TAGGGGTCCCAGCAAAATGGAGG No data
1005918765_1005918774 28 Left 1005918765 6:30379569-30379591 CCTGCAGTCCTTTGAGCATGGGG No data
Right 1005918774 6:30379620-30379642 TAGGGGTCCCAGCAAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005918774 Original CRISPR TAGGGGTCCCAGCAAAATGG AGG Intergenic
No off target data available for this crispr