ID: 1005923152

View in Genome Browser
Species Human (GRCh38)
Location 6:30418280-30418302
Sequence CCTGGAGTGCAGAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005923138_1005923152 26 Left 1005923138 6:30418231-30418253 CCTCTCCAGGAGGGTCCATGTTG No data
Right 1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG No data
1005923143_1005923152 11 Left 1005923143 6:30418246-30418268 CCATGTTGGAGATGGTGGTTGTG No data
Right 1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG No data
1005923140_1005923152 21 Left 1005923140 6:30418236-30418258 CCAGGAGGGTCCATGTTGGAGAT No data
Right 1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005923152 Original CRISPR CCTGGAGTGCAGAGGGTGGG TGG Intergenic
No off target data available for this crispr