ID: 1005925564

View in Genome Browser
Species Human (GRCh38)
Location 6:30442431-30442453
Sequence CAGAGTGAACTTTCTAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005925564_1005925565 -4 Left 1005925564 6:30442431-30442453 CCAACATTAGAAAGTTCACTCTG No data
Right 1005925565 6:30442450-30442472 TCTGAGATGATGATAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005925564 Original CRISPR CAGAGTGAACTTTCTAATGT TGG (reversed) Intergenic
No off target data available for this crispr