ID: 1005926720

View in Genome Browser
Species Human (GRCh38)
Location 6:30451275-30451297
Sequence GAGTTGGGCAGCGCCGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005926704_1005926720 25 Left 1005926704 6:30451227-30451249 CCGGGAAGCCTTGAAACTCAACT No data
Right 1005926720 6:30451275-30451297 GAGTTGGGCAGCGCCGGCCGGGG No data
1005926712_1005926720 2 Left 1005926712 6:30451250-30451272 CCTGGGTGGGCCAGGAAGGTTGT No data
Right 1005926720 6:30451275-30451297 GAGTTGGGCAGCGCCGGCCGGGG No data
1005926703_1005926720 30 Left 1005926703 6:30451222-30451244 CCTCTCCGGGAAGCCTTGAAACT No data
Right 1005926720 6:30451275-30451297 GAGTTGGGCAGCGCCGGCCGGGG No data
1005926714_1005926720 -8 Left 1005926714 6:30451260-30451282 CCAGGAAGGTTGTCCGAGTTGGG No data
Right 1005926720 6:30451275-30451297 GAGTTGGGCAGCGCCGGCCGGGG No data
1005926707_1005926720 17 Left 1005926707 6:30451235-30451257 CCTTGAAACTCAACTCCTGGGTG No data
Right 1005926720 6:30451275-30451297 GAGTTGGGCAGCGCCGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005926720 Original CRISPR GAGTTGGGCAGCGCCGGCCG GGG Intergenic
No off target data available for this crispr