ID: 1005931676

View in Genome Browser
Species Human (GRCh38)
Location 6:30489587-30489609
Sequence GACCCCGCACTCACCCGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 4, 1: 4, 2: 1, 3: 15, 4: 162}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005931676_1005931690 25 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931690 6:30489635-30489657 GTAGAGAGGGGCCGGCCCGGCGG 0: 1
1: 0
2: 2
3: 30
4: 202
1005931676_1005931682 1 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931682 6:30489611-30489633 GGATGGAAACGGCCTCTACCGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1005931676_1005931686 13 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931686 6:30489623-30489645 CCTCTACCGGGAGTAGAGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 71
1005931676_1005931692 27 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931692 6:30489637-30489659 AGAGAGGGGCCGGCCCGGCGGGG 0: 1
1: 1
2: 4
3: 52
4: 409
1005931676_1005931683 11 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931683 6:30489621-30489643 GGCCTCTACCGGGAGTAGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 90
1005931676_1005931680 -10 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931680 6:30489600-30489622 GTGCGGGGTCGGGATGGAAACGG 0: 1
1: 2
2: 1
3: 16
4: 192
1005931676_1005931687 17 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931687 6:30489627-30489649 TACCGGGAGTAGAGAGGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 213
1005931676_1005931684 12 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931684 6:30489622-30489644 GCCTCTACCGGGAGTAGAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 80
1005931676_1005931689 22 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931689 6:30489632-30489654 GGAGTAGAGAGGGGCCGGCCCGG 0: 1
1: 0
2: 3
3: 34
4: 337
1005931676_1005931681 0 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931681 6:30489610-30489632 GGGATGGAAACGGCCTCTACCGG 0: 1
1: 0
2: 0
3: 8
4: 83
1005931676_1005931691 26 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931691 6:30489636-30489658 TAGAGAGGGGCCGGCCCGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 160
1005931676_1005931693 28 Left 1005931676 6:30489587-30489609 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005931693 6:30489638-30489660 GAGAGGGGCCGGCCCGGCGGGGG 0: 1
1: 1
2: 8
3: 60
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005931676 Original CRISPR GACCCCGCACTCACCCGCCC AGG (reversed) Exonic