ID: 1005931817

View in Genome Browser
Species Human (GRCh38)
Location 6:30490115-30490137
Sequence CCTAGACCGGGGAGAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005931802_1005931817 14 Left 1005931802 6:30490078-30490100 CCCAGATTCACCCCAAGGCTGCG 0: 1
1: 0
2: 2
3: 8
4: 118
Right 1005931817 6:30490115-30490137 CCTAGACCGGGGAGAGTCTCAGG 0: 1
1: 0
2: 1
3: 1
4: 73
1005931800_1005931817 30 Left 1005931800 6:30490062-30490084 CCTCGAATCTTCGGGTCCCAGAT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1005931817 6:30490115-30490137 CCTAGACCGGGGAGAGTCTCAGG 0: 1
1: 0
2: 1
3: 1
4: 73
1005931805_1005931817 4 Left 1005931805 6:30490088-30490110 CCCCAAGGCTGCGGAACCCGCCC 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1005931817 6:30490115-30490137 CCTAGACCGGGGAGAGTCTCAGG 0: 1
1: 0
2: 1
3: 1
4: 73
1005931807_1005931817 2 Left 1005931807 6:30490090-30490112 CCAAGGCTGCGGAACCCGCCCAG 0: 1
1: 0
2: 4
3: 9
4: 121
Right 1005931817 6:30490115-30490137 CCTAGACCGGGGAGAGTCTCAGG 0: 1
1: 0
2: 1
3: 1
4: 73
1005931803_1005931817 13 Left 1005931803 6:30490079-30490101 CCAGATTCACCCCAAGGCTGCGG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1005931817 6:30490115-30490137 CCTAGACCGGGGAGAGTCTCAGG 0: 1
1: 0
2: 1
3: 1
4: 73
1005931806_1005931817 3 Left 1005931806 6:30490089-30490111 CCCAAGGCTGCGGAACCCGCCCA 0: 1
1: 0
2: 0
3: 12
4: 74
Right 1005931817 6:30490115-30490137 CCTAGACCGGGGAGAGTCTCAGG 0: 1
1: 0
2: 1
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005931817 Original CRISPR CCTAGACCGGGGAGAGTCTC AGG Intronic
911051547 1:93675772-93675794 CCTAGATAGGAGAGAGTGTCGGG - Intronic
920089379 1:203441460-203441482 CCTAGAGCAGGGACCGTCTCTGG - Intergenic
920441748 1:205985480-205985502 CCTGGATTGGGGAGGGTCTCGGG - Intronic
1067298385 10:44989102-44989124 CCCAGACCTGGGAGACACTCCGG - Intronic
1069627952 10:69880060-69880082 GCTGGGCCGGGGAGAGACTCAGG + Intronic
1069889564 10:71644575-71644597 CTTAGACCACGGAGAGTCTTTGG + Intronic
1075105365 10:119536700-119536722 CCTAGAAAGTGGAGAGTCTAGGG - Intronic
1075948545 10:126458097-126458119 CATAGACTGGGGAGATTCACAGG + Intronic
1076516921 10:131050997-131051019 GCTGGACTGGGGAGAGTCCCTGG + Intergenic
1078004195 11:7520037-7520059 CCGAAACCTGGGAGAGGCTCGGG - Intronic
1081995973 11:47364376-47364398 CCTACAGCGAGGAGAGTTTCGGG - Intronic
1084672752 11:70616757-70616779 CCTGGGCCAGGGAGAGGCTCTGG - Intronic
1085226587 11:74926931-74926953 CTTAGACCAGGATGAGTCTCTGG + Intronic
1088582942 11:111332756-111332778 CCTACACCTGGGATAGACTCAGG - Intergenic
1090375115 11:126283002-126283024 TCCAGACCCGGGAGACTCTCGGG - Intergenic
1091686231 12:2564831-2564853 TCTAGACCAGGGAGAGTATGAGG - Intronic
1097419965 12:59364723-59364745 CCTAGACTGAGGAGTTTCTCAGG + Intergenic
1113279841 13:108777425-108777447 CCCACATCGGGGAGAGTATCTGG + Intronic
1114237640 14:20836274-20836296 CCAAAACCCGGGAGAGGCTCAGG - Intergenic
1114628424 14:24144353-24144375 CTTAGAGTGGGGAGAGCCTCAGG - Intronic
1116950273 14:50872488-50872510 CCTGGACCAGCGAGACTCTCAGG + Intronic
1119709102 14:76808534-76808556 CCTAAACCTGGAAGAGTCTGTGG + Intronic
1121219304 14:92274154-92274176 CCAACACTGGGGAGAGTCCCGGG - Intergenic
1134662284 16:15993171-15993193 CCTAGACCTGGGCTAGTCACAGG - Intronic
1140046292 16:71442220-71442242 CCTGTACCGGGCAGGGTCTCAGG - Intergenic
1142802207 17:2353339-2353361 CCTAGATTGGAGAGACTCTCTGG + Intronic
1143489980 17:7280769-7280791 CCCAGAGCGTGGAGAGTGTCTGG - Intergenic
1148577444 17:48722040-48722062 CCTAGGCGGGGGAGAGGCTTGGG - Intronic
1151442098 17:74136071-74136093 CCAACCCAGGGGAGAGTCTCTGG - Intergenic
1203183065 17_KI270729v1_random:83717-83739 CCCAGACCAGGGAGTATCTCAGG + Intergenic
1156459712 18:37314877-37314899 CATTGACCAGGGAGAGACTCGGG + Intronic
1158106891 18:53895542-53895564 CCTAGACCTGGGAGGGGGTCCGG - Intergenic
1161935300 19:7368304-7368326 CCTAGACCTGGGGGAGCCTTGGG - Intronic
1163583621 19:18152842-18152864 CCAAGACCGCGGAGCGTTTCTGG - Intergenic
930026976 2:47034852-47034874 CCTGTACTGGGGAGGGTCTCCGG - Intronic
935281559 2:101522223-101522245 CCTAGACTGGGGAGAATATAGGG + Intergenic
936817975 2:116484081-116484103 CCCACACTGGGGAGACTCTCTGG - Intergenic
1172176542 20:32975944-32975966 CCTAGAACGGGTAGTGTCTCAGG + Intergenic
1176199916 20:63855551-63855573 CCTAGATCTGGGGGAGCCTCCGG - Intergenic
1176305118 21:5119156-5119178 CCCAGACTGGCGAGAGTCCCGGG + Intronic
1179248920 21:39656740-39656762 CCTGGCCTGGGGAGAGTCCCAGG + Intronic
1179851937 21:44142874-44142896 CCCAGACTGGCGAGAGTCCCGGG - Intronic
1181615465 22:24051341-24051363 CCCAGACCCGGGACTGTCTCTGG - Intronic
1183547981 22:38465543-38465565 CCAAGGCCAGGGAGAGTCTGAGG - Intergenic
953869789 3:46616289-46616311 CCTATACCCTGCAGAGTCTCAGG + Intronic
955212376 3:56954261-56954283 CCTAGAGCTGTGAAAGTCTCTGG - Intronic
961766643 3:129216797-129216819 CCTTGAAGGTGGAGAGTCTCTGG + Intergenic
969035655 4:4251411-4251433 CCTAGGACGGGGTCAGTCTCTGG - Intergenic
969394365 4:6910557-6910579 CCTGGCCCGGGGACTGTCTCGGG + Intronic
972340298 4:38146769-38146791 CCTAGACTGGGGAGGTTCTGAGG + Intergenic
973259691 4:48150288-48150310 CCTAGACGGGAGAGAGTATATGG - Intronic
989586163 5:43075235-43075257 CCGAAACCGGGGAGGGGCTCTGG - Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
998179143 5:139924185-139924207 CCTAGATGGGGGAGAGCCCCTGG + Intronic
1001187994 5:169595636-169595658 CCCAGACAGGGGAGAGTCTCAGG - Intronic
1002946424 6:1765780-1765802 CCTCCATCGGGGAGTGTCTCGGG - Intronic
1005838318 6:29724047-29724069 CCTCCACCCGGGAGAGTCCCAGG + Intronic
1005847490 6:29792824-29792846 CCTTGACCCGGGAGAGGCCCAGG + Intergenic
1005859225 6:29888341-29888363 CCTTGACCTGGGAGAGGCCCAGG + Intergenic
1005864385 6:29927051-29927073 CCTCGACCCGGGAGAGGCCCAGG + Intergenic
1005875447 6:30007191-30007213 CCTCGACCCGGGAGAGCCCCAGG + Intergenic
1005931817 6:30490115-30490137 CCTAGACCGGGGAGAGTCTCAGG + Intronic
1006052740 6:31356546-31356568 CCTCGACCGGCGAGAGCCCCAGG - Intronic
1024551214 7:50564009-50564031 CCAGGAAAGGGGAGAGTCTCAGG - Intronic
1024806055 7:53141461-53141483 CCCAGACAAGGGAGTGTCTCAGG - Intergenic
1025187376 7:56871512-56871534 CCTAGACAGAGGAGAGGCTGGGG + Intergenic
1025684549 7:63705408-63705430 CCTAGACAGAGGAGAGGCTGGGG - Intergenic
1026980884 7:74526067-74526089 CCTGGGGCGGGGAGAGACTCAGG - Intronic
1046762606 8:118036936-118036958 CCTAGACCCTGGAGATTCTTAGG - Intronic
1047210504 8:122836426-122836448 CCAAAACCGGGGAGGGGCTCAGG - Intronic
1049588957 8:143446903-143446925 CCAAGACAGTGGAGAGCCTCAGG + Intronic
1059459525 9:114420980-114421002 CCTAGACCAGGGTGAGCCCCTGG - Intronic
1059600068 9:115767560-115767582 TCTAGACTGGGGAGAGTTCCAGG + Intergenic
1062297442 9:135840253-135840275 CCGAGGCTGGGGAGTGTCTCTGG - Intronic
1196424663 X:115558234-115558256 GCTAGACTGGGGAGAGTGTTGGG + Intergenic
1201321350 Y:12701176-12701198 CCTAGACAGGGGCAAGTCCCTGG - Intergenic