ID: 1005935947

View in Genome Browser
Species Human (GRCh38)
Location 6:30521060-30521082
Sequence GTACACTCCTGCCCAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005935942_1005935947 14 Left 1005935942 6:30521023-30521045 CCAAGGGAAGCCGTGACAGACTG 0: 97
1: 384
2: 799
3: 1243
4: 1248
Right 1005935947 6:30521060-30521082 GTACACTCCTGCCCAAATACTGG No data
1005935944_1005935947 4 Left 1005935944 6:30521033-30521055 CCGTGACAGACTGTACCTGGAGG 0: 12
1: 46
2: 251
3: 355
4: 580
Right 1005935947 6:30521060-30521082 GTACACTCCTGCCCAAATACTGG No data
1005935939_1005935947 25 Left 1005935939 6:30521012-30521034 CCCTTTCCTAGCCAAGGGAAGCC 0: 644
1: 968
2: 1033
3: 956
4: 844
Right 1005935947 6:30521060-30521082 GTACACTCCTGCCCAAATACTGG No data
1005935941_1005935947 19 Left 1005935941 6:30521018-30521040 CCTAGCCAAGGGAAGCCGTGACA 0: 249
1: 835
2: 898
3: 1224
4: 1142
Right 1005935947 6:30521060-30521082 GTACACTCCTGCCCAAATACTGG No data
1005935940_1005935947 24 Left 1005935940 6:30521013-30521035 CCTTTCCTAGCCAAGGGAAGCCG 0: 263
1: 967
2: 938
3: 1076
4: 944
Right 1005935947 6:30521060-30521082 GTACACTCCTGCCCAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005935947 Original CRISPR GTACACTCCTGCCCAAATAC TGG Intergenic
No off target data available for this crispr