ID: 1005940300

View in Genome Browser
Species Human (GRCh38)
Location 6:30555665-30555687
Sequence GCCGCAGCGGGAGCCGGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 401}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005940300_1005940307 16 Left 1005940300 6:30555665-30555687 CCGCTCCCGGCTCCCGCTGCGGC 0: 1
1: 0
2: 2
3: 49
4: 401
Right 1005940307 6:30555704-30555726 CAGCCCATCTTGAAGCCCTGCGG 0: 1
1: 0
2: 4
3: 17
4: 183
1005940300_1005940313 22 Left 1005940300 6:30555665-30555687 CCGCTCCCGGCTCCCGCTGCGGC 0: 1
1: 0
2: 2
3: 49
4: 401
Right 1005940313 6:30555710-30555732 ATCTTGAAGCCCTGCGGGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 121
1005940300_1005940309 18 Left 1005940300 6:30555665-30555687 CCGCTCCCGGCTCCCGCTGCGGC 0: 1
1: 0
2: 2
3: 49
4: 401
Right 1005940309 6:30555706-30555728 GCCCATCTTGAAGCCCTGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 109
1005940300_1005940314 23 Left 1005940300 6:30555665-30555687 CCGCTCCCGGCTCCCGCTGCGGC 0: 1
1: 0
2: 2
3: 49
4: 401
Right 1005940314 6:30555711-30555733 TCTTGAAGCCCTGCGGGGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 169
1005940300_1005940308 17 Left 1005940300 6:30555665-30555687 CCGCTCCCGGCTCCCGCTGCGGC 0: 1
1: 0
2: 2
3: 49
4: 401
Right 1005940308 6:30555705-30555727 AGCCCATCTTGAAGCCCTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 160
1005940300_1005940312 21 Left 1005940300 6:30555665-30555687 CCGCTCCCGGCTCCCGCTGCGGC 0: 1
1: 0
2: 2
3: 49
4: 401
Right 1005940312 6:30555709-30555731 CATCTTGAAGCCCTGCGGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
1005940300_1005940315 27 Left 1005940300 6:30555665-30555687 CCGCTCCCGGCTCCCGCTGCGGC 0: 1
1: 0
2: 2
3: 49
4: 401
Right 1005940315 6:30555715-30555737 GAAGCCCTGCGGGGAGGGGCCGG 0: 1
1: 0
2: 6
3: 83
4: 644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005940300 Original CRISPR GCCGCAGCGGGAGCCGGGAG CGG (reversed) Exonic
900110860 1:1005014-1005036 GCAGAGGCGGGAGCTGGGAGGGG - Intergenic
900152058 1:1183050-1183072 GCGGCGGCGGGTGCCCGGAGGGG + Intronic
900207016 1:1435932-1435954 GAGGCTGCGGGAGCCGGGCGGGG + Intronic
900359163 1:2279569-2279591 GCTGCAGGGGGAGGGGGGAGGGG + Intronic
900603087 1:3511495-3511517 GCAGCAGCGGGTCCCTGGAGTGG + Intronic
900979928 1:6040595-6040617 GCCGCAGCGAGAGCCGAGCCGGG - Intronic
901007984 1:6180729-6180751 GCCGAGGCCGGAGCCGGGAGCGG - Intergenic
901022113 1:6260862-6260884 ACCGCAGCCGGAGCCGGAGGCGG - Exonic
901125530 1:6925911-6925933 GTTACAGCTGGAGCCGGGAGGGG - Intronic
902222616 1:14976604-14976626 GCCCCAGAGGAGGCCGGGAGGGG + Intronic
902251007 1:15154112-15154134 GCCGCAGAGGGTGCGGGGTGCGG - Intronic
902990463 1:20184050-20184072 GCCCCAGGGGGAGGCAGGAGAGG - Intergenic
903016822 1:20366794-20366816 GTCGCAGTGGGAACCGGGAGGGG + Intergenic
903363120 1:22789509-22789531 GGCACAGCGGGAGAGGGGAGGGG + Intronic
903466061 1:23553598-23553620 GGGGCAGCGGAAGCCTGGAGAGG - Intergenic
903889249 1:26558677-26558699 GCCGTGGCGGGAGCCTGCAGAGG - Intronic
904039349 1:27575348-27575370 TCCGCCGCGCAAGCCGGGAGGGG + Intronic
905868221 1:41387859-41387881 CCAGCAAAGGGAGCCGGGAGGGG - Intergenic
906323398 1:44830017-44830039 GCCACATTGGGAGCCTGGAGGGG + Exonic
911090960 1:94016480-94016502 GAGGCAGCTGGAGCAGGGAGAGG + Intronic
913196094 1:116457471-116457493 GCAGCAGCAGGTGGCGGGAGAGG - Intergenic
913205513 1:116534595-116534617 GGCGCACCGGGTGCTGGGAGGGG + Intronic
914001719 1:143699944-143699966 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914005625 1:143729888-143729910 CCCGCTGCCGGAGCCGGCAGGGG + Intergenic
914098091 1:144561134-144561156 CCCGCTGCCGGAGCCGGCAGGGG + Intergenic
914300891 1:146376481-146376503 CCCGCTGCCGGAGCCGGCAGGGG - Intergenic
914514565 1:148362851-148362873 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914753825 1:150552251-150552273 GCCCCAGGGGGAGGCAGGAGCGG - Exonic
915544172 1:156586492-156586514 GCCTCAGCAGGAGCCGCCAGAGG + Exonic
916548300 1:165827488-165827510 GCGGCGGCGGGGCCCGGGAGGGG + Intronic
916694370 1:167221257-167221279 GCGGCAGCGGCGGCCGGCAGAGG - Intronic
917929884 1:179815791-179815813 GCCGCTGGGGGAGCAGGGAGCGG + Exonic
918388757 1:184037048-184037070 GCCGCGGCGGGACGCGGGGGCGG - Intronic
919809375 1:201399242-201399264 GCGCCGGAGGGAGCCGGGAGGGG - Intronic
920116867 1:203627722-203627744 GCTGCAGCGGGAACTAGGAGAGG + Intronic
920279823 1:204834454-204834476 AGAGCAGCAGGAGCCGGGAGGGG - Intronic
920788295 1:209063886-209063908 GCGGCAGTGGGAGCTGGGTGGGG - Intergenic
923263529 1:232290036-232290058 GGAGCAGTGGGAGCAGGGAGAGG - Intergenic
923783118 1:237042862-237042884 GGAGCTGCGGGAACCGGGAGAGG + Intronic
924289603 1:242524358-242524380 GGCCCAGCGGGAGCCGGAGGTGG + Exonic
924653133 1:245948703-245948725 GCAGCAGCAGGAGCCAGCAGTGG - Intronic
924944630 1:248838176-248838198 GCCCGCGCGGGAGGCGGGAGTGG + Intergenic
1063960420 10:11301520-11301542 GGGGCAGCGGGAGCGGGGTGGGG - Intronic
1069556457 10:69401620-69401642 GCCACAGTGGGTGCCAGGAGGGG - Exonic
1070864681 10:79700738-79700760 GCCGCAACCGGCGCTGGGAGCGG + Intergenic
1070878469 10:79838866-79838888 GCCGCAACTGGCGCTGGGAGCGG + Intergenic
1071645025 10:87355177-87355199 GCCGCAACTGGCGCTGGGAGCGG + Intergenic
1072930766 10:99659760-99659782 GACGGAGCGGGAGCCTGGGGAGG + Intronic
1073099635 10:100999869-100999891 GCCGGAGCCGGAGCCGGGGCCGG + Exonic
1073108523 10:101047335-101047357 GATGCAGCTGGAGGCGGGAGAGG + Intergenic
1073136836 10:101224874-101224896 CCCGCACCGGGAGCCGCGGGGGG + Intergenic
1073251121 10:102120789-102120811 GCCGGAGCGGGAGCCGCGGCTGG + Intergenic
1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG + Intronic
1074419897 10:113299550-113299572 GGCGCTGCAGGCGCCGGGAGCGG + Intergenic
1074585982 10:114768167-114768189 CCCGCACCGGGAGCCGGAGGGGG - Intergenic
1075075254 10:119346248-119346270 GCCGCAGCGGGGCCGAGGAGAGG + Intronic
1075865971 10:125719614-125719636 CCCGCAGCGGGAGGCGGGGCCGG + Exonic
1076692477 10:132230824-132230846 GGGGCAGAGGGAGCCTGGAGAGG - Intronic
1076830569 10:132992333-132992355 GCAGCAGCGGGGGCGGGGGGAGG + Intergenic
1076886395 10:133264741-133264763 GCTGCAGCAAGAGCCGGGCGTGG - Intronic
1076886412 10:133264821-133264843 GCTGCAGCAGGAGCCGGGCGTGG - Intronic
1076886454 10:133265019-133265041 GCTGCAGCAGGAGCCGGGCGTGG - Intronic
1076886463 10:133265059-133265081 GCTGCAGCAGGAGCTGGGCGTGG - Intronic
1076886489 10:133265178-133265200 GCTGCAGCAGGAGCTGGGCGTGG - Intronic
1076886498 10:133265218-133265240 GCTGCAGCAGGAGCTGGGCGTGG - Intronic
1076886508 10:133265258-133265280 GCTGCAGCAGGAGCCGGGCGTGG - Intronic
1076886518 10:133265298-133265320 GCTGCAGCAGGAGCCGGGCGTGG - Intronic
1077023563 11:430242-430264 GCCGCAGCAGGGGCCGGGCATGG - Intronic
1077284394 11:1759287-1759309 GCCACAGAGGGAGCCGGCTGTGG - Intronic
1077495519 11:2884924-2884946 GCCGGAGCCGGAGCCGGGGCCGG + Exonic
1077610840 11:3642331-3642353 GCCGCACGCGGGGCCGGGAGCGG + Intergenic
1078377537 11:10808594-10808616 GCCGCAGGCGGAGCCGGGTGGGG - Intronic
1078432306 11:11297546-11297568 GGGGCAGGGGGAGCCGGGAGAGG + Intronic
1078659829 11:13277870-13277892 GCCGCCGCGGGATCCGAGTGCGG + Exonic
1079426032 11:20342968-20342990 GCTCCAGCGGGGGCCGGGCGGGG - Intergenic
1081700022 11:45146960-45146982 GCCGGTGCGGGGGCCGGGAGCGG + Intronic
1081773870 11:45665109-45665131 TCCGCCGCAGCAGCCGGGAGGGG - Intronic
1082076653 11:47980596-47980618 GCAGCCGCGGGAGCCGGGACCGG + Exonic
1083616347 11:64028419-64028441 GCTGCAGAGGGAGGAGGGAGAGG + Intronic
1083656929 11:64234417-64234439 GCCGCGGCGGGAGGCGGGAGGGG + Intergenic
1083882092 11:65553781-65553803 GCGGCAGCAGGTGCTGGGAGGGG + Exonic
1083899788 11:65638098-65638120 GGCGGAGCCGGCGCCGGGAGCGG + Intronic
1084192029 11:67503787-67503809 GCGGCAGAGGAAGGCGGGAGGGG - Intronic
1084265860 11:68004751-68004773 GCTGCAGCGGGAGCCTGTGGTGG + Intronic
1084667973 11:70586746-70586768 CTCGCAGCTGGAGCCGGGAGTGG + Intronic
1084758380 11:71252734-71252756 GCCGCAGCCGCGGGCGGGAGCGG - Intergenic
1085011110 11:73142260-73142282 GCCGCTGCGTCCGCCGGGAGCGG - Exonic
1089128431 11:116193571-116193593 CCCGGAGCCGGAGCCGGGAATGG - Intergenic
1089543675 11:119206310-119206332 GCGGCGGCGGCGGCCGGGAGAGG + Exonic
1089800632 11:121024209-121024231 GCGACAGCGGTGGCCGGGAGGGG + Exonic
1090619627 11:128549350-128549372 GCCGCGGCCGGAGCCGAGCGGGG + Intronic
1090662336 11:128891144-128891166 GGGGCAGGGGGAGCCGGGGGAGG + Intergenic
1090736866 11:129618079-129618101 GGGCCAGCGGGAGCCTGGAGGGG + Intergenic
1091616151 12:2052759-2052781 GCTGCCGCGGGCGCCGGGAGGGG + Intronic
1091768622 12:3137645-3137667 GACGCAGCTGGAGCAGGGGGTGG - Intronic
1092231540 12:6778333-6778355 GCCGGAGCCGGAGCCGGAACCGG + Exonic
1092260783 12:6952289-6952311 GCCCCAGCTGGTGCAGGGAGGGG - Intronic
1092936116 12:13366192-13366214 GCCTCAGCGGGAGCCCGCGGAGG - Intergenic
1093084165 12:14848202-14848224 GCCTCAGTGGGAGCCGGGCCTGG - Intronic
1095860125 12:46907740-46907762 GCTGCAGGGGGAGAGGGGAGGGG - Intergenic
1096154972 12:49336672-49336694 GCCGCGGCTGGAGCCCGCAGAGG - Exonic
1096298057 12:50400859-50400881 GCCGCAGCGGCTGACGGCAGGGG + Intronic
1097053068 12:56235206-56235228 GCCGCAGCAGCAGCAGGGATAGG - Exonic
1098161034 12:67648636-67648658 GCGGCCGGGGGAGCCGGGGGCGG + Intronic
1099557504 12:84128508-84128530 TGGGCACCGGGAGCCGGGAGAGG - Intergenic
1101431899 12:104633867-104633889 GGGGCAGGGGGAGCTGGGAGTGG - Intronic
1101640812 12:106584694-106584716 GCTGCAGCGGAAACCTGGAGAGG - Intronic
1101789118 12:107911949-107911971 TCCGGAGGGGCAGCCGGGAGAGG + Intergenic
1102171346 12:110844923-110844945 GCCGCAGAGGGACCAGGCAGAGG - Intergenic
1102453317 12:113056970-113056992 CCCCCAGCGGGAGCCGGGGGTGG - Intronic
1102561560 12:113766174-113766196 GCGGCCGCGGGGGCCGGGTGGGG - Intergenic
1103764494 12:123271162-123271184 GCCGCGCCGGGAGCGGGGCGCGG - Intronic
1103925775 12:124422709-124422731 GCTGCTGCGGCAGACGGGAGGGG + Intronic
1104768456 12:131345614-131345636 TCCCCAGCTGGAGCCTGGAGGGG + Intergenic
1104811590 12:131622974-131622996 TCCCCAGCTGGAGCCTGGAGGGG - Intergenic
1105492616 13:20902957-20902979 GCCGCAGCCGGCACCGGGCGAGG + Intronic
1105545501 13:21347932-21347954 GCCACAGCTGCAGCCCGGAGAGG + Intergenic
1107108864 13:36674440-36674462 GCTGCAGGAGGAGCCGCGAGGGG + Intronic
1107770737 13:43786264-43786286 CCCGCAGGGGGAGACGGGTGCGG + Intronic
1108029246 13:46211854-46211876 GGCGAGGCGGGCGCCGGGAGGGG - Intronic
1112091723 13:96090564-96090586 GCCGGGGCGGGAGCAGGGAGCGG + Intergenic
1112290922 13:98143441-98143463 CCCGGAGCCCGAGCCGGGAGAGG + Intronic
1112415534 13:99200868-99200890 GCCCCAGAGGGCGCCGGGGGAGG - Exonic
1113483836 13:110640596-110640618 GCAGCAGCGGGACCCGTGACTGG - Intergenic
1113494056 13:110714016-110714038 GCCGAAGCAGGAGCCGGCGGGGG + Intronic
1113656195 13:112068885-112068907 GGCGGGGCGGGAGCCGGGCGCGG - Exonic
1113830111 13:113289019-113289041 TCAGCAGCTGGAGCCAGGAGAGG + Intergenic
1114259121 14:21025022-21025044 GCCGCGGCGGCAGCAGGTAGGGG - Intronic
1114736726 14:25050016-25050038 GCCGGCGCGGGAGCCGCGAGCGG - Exonic
1115762033 14:36584400-36584422 GCCGGGGCGGGAGCCTGGAGTGG + Intergenic
1116827696 14:49688252-49688274 GCCGAGGCCGGAGCTGGGAGGGG - Exonic
1116887038 14:50231639-50231661 GCCGTAGCGGGAGTCGGGGCGGG - Intergenic
1118186455 14:63542846-63542868 GCCGCAGCGGGGGCGGGCGGCGG + Exonic
1118350970 14:64972260-64972282 GCTGCGGCGGGAGCCCGGCGCGG + Intronic
1118835246 14:69473352-69473374 GCTGCAGCTGGGGCGGGGAGAGG - Intergenic
1120142194 14:80941630-80941652 GTAGCCGCGGGAGCCGGGTGGGG - Exonic
1121245227 14:92457232-92457254 GCTGCAGCAGGGGCCAGGAGAGG - Intronic
1122068614 14:99190880-99190902 GCCGAAGCGGGCGGTGGGAGTGG - Intronic
1122233337 14:100318321-100318343 GCCGCAGAGGGCTTCGGGAGGGG - Intergenic
1122291286 14:100681688-100681710 GCCACGACAGGAGCCGGGAGGGG + Intergenic
1122516857 14:102314849-102314871 GCCGCGGAGGGAGCCGGGCAGGG + Intergenic
1122542839 14:102507560-102507582 GCAGCAGCGGAAGCCGGCACTGG + Exonic
1122786148 14:104164145-104164167 GCCGCAGTGGGGGCAGCGAGAGG + Intronic
1124494161 15:30176246-30176268 GCCACACCGGGACCTGGGAGAGG + Intergenic
1124635985 15:31365591-31365613 GGTGCAGCTGGAGCCGGGTGGGG + Intronic
1124749409 15:32362399-32362421 GCCACACCGGGACCTGGGAGAGG - Intergenic
1124999509 15:34755252-34755274 GGCGGAGGGGGAGCCGGGAGCGG + Intergenic
1125594252 15:40874115-40874137 GCCGCCGCGGGAGCTGAGCGAGG - Exonic
1125598538 15:40902873-40902895 GCTGCAGCGGGAGATGGAAGAGG + Exonic
1126172381 15:45705139-45705161 GCCGTAGCGGGGGGCGGGGGGGG - Intergenic
1127588149 15:60397650-60397672 GCCCTAGCGGGAGCGGGGCGAGG - Intronic
1128028615 15:64460702-64460724 GCCGGAGCCGGAGCCGGGGTGGG + Intergenic
1128315109 15:66655122-66655144 GCCGGGCCGGGAGCCGGGTGGGG - Intronic
1128616414 15:69114064-69114086 GTCGCAGAGGCAGCAGGGAGCGG - Intergenic
1129390937 15:75220663-75220685 GCAGCAGCGTGAGCTGGGAGCGG + Intergenic
1129675622 15:77631441-77631463 ACCCCAGCAGGAACCGGGAGGGG + Intronic
1129692961 15:77724101-77724123 CCCGGAGCAGGAGCGGGGAGTGG + Intronic
1130305196 15:82708815-82708837 GGGGCAGTGGGAGCAGGGAGAGG - Intronic
1131983388 15:98017412-98017434 GCTGCAGAGGGAGCAGGGGGAGG - Intergenic
1132512725 16:352392-352414 GCCGCTCCGGGAGCCGGGCCCGG - Exonic
1132671212 16:1102915-1102937 GCCGGGGAGGGAGCCGGGAGGGG - Intergenic
1132875543 16:2135442-2135464 GGCCCAGCGGCACCCGGGAGAGG - Intronic
1133033178 16:3021218-3021240 GCTGCCGCGGGAGCAGGGGGCGG - Exonic
1133156743 16:3881021-3881043 GCCCCAGCGGGCTCCGGGAGCGG + Intergenic
1134018612 16:10906610-10906632 GCAGCAGCAAGAGCCTGGAGCGG + Exonic
1134519444 16:14911918-14911940 GGCCCAGCGGCACCCGGGAGAGG + Intronic
1134554492 16:15154317-15154339 GGCCCAGCGGCACCCGGGAGAGG - Intergenic
1134624658 16:15714967-15714989 GCTGCAGCGGGAGCTGGATGAGG - Exonic
1134707114 16:16310573-16310595 GGCCCAGCGGCACCCGGGAGAGG + Intergenic
1134960426 16:18401551-18401573 GGCCCAGCGGCACCCGGGAGAGG - Intergenic
1135976147 16:27109945-27109967 GGCGGGGCGGGAGCGGGGAGCGG - Intergenic
1136478409 16:30526841-30526863 GCCGCGGCGCGAGCCGGCGGGGG - Intronic
1137602815 16:49768220-49768242 CCCTGAGCGGGAGCCGGGAACGG + Intronic
1137668624 16:50266509-50266531 GCCGCTGCCGGAGCAGGAAGTGG + Exonic
1137739866 16:50758355-50758377 GCCGCAGTGGGAGCTGGAACAGG + Intronic
1138016648 16:53434584-53434606 GCCGGAGGGGGAGGCGGGGGCGG - Exonic
1138142761 16:54582909-54582931 GCGGGAGGGCGAGCCGGGAGGGG - Intergenic
1138328107 16:56191850-56191872 GCCGCAGCCGGAGCCGACAGAGG - Intronic
1138360766 16:56425497-56425519 GCAGCAGCGGGAGCAGCGCGGGG - Exonic
1139477129 16:67208371-67208393 CCCGCAGCGTGAGCAGGGAGGGG + Exonic
1139505522 16:67396373-67396395 GGCGGGGTGGGAGCCGGGAGGGG + Intronic
1140478455 16:75250485-75250507 GCTGCGGCGGGCCCCGGGAGGGG + Intronic
1142138866 16:88463737-88463759 GGCCCAGCGGGAGCAGGGAAAGG - Intronic
1142523329 17:520021-520043 ACCGCAGGAGGAGACGGGAGCGG + Intronic
1142838653 17:2609298-2609320 CAGGCAGCGGGAGCCGGGCGCGG - Intronic
1143091016 17:4449198-4449220 GCCCCAGCTGGAGTTGGGAGAGG - Intronic
1143548530 17:7614627-7614649 GCCGGAGGGGGAGCCGCGGGGGG + Exonic
1143608251 17:8003143-8003165 GCAGGAGCGGGAGCCGGGGCAGG - Exonic
1144788590 17:17845289-17845311 GCCCCAGGGGCAGCAGGGAGTGG - Intronic
1145733442 17:27211289-27211311 GAGGCAGAGGGAGACGGGAGAGG - Intergenic
1146915026 17:36673005-36673027 GCAGTGGCAGGAGCCGGGAGAGG - Intergenic
1147183648 17:38702355-38702377 GCCGCCGCCGGAGCCGAGCGGGG - Intergenic
1147382246 17:40062861-40062883 GCCCCAGCCGGAGCGGGGCGGGG + Exonic
1147508781 17:41047247-41047269 GCCGCAGCAGGAGCCGGTCATGG + Exonic
1147509520 17:41055191-41055213 GCCGCAGCAGGAGCCGGTCATGG + Exonic
1147510028 17:41060030-41060052 GCCGCAGCAGGAGCCGGTCATGG + Exonic
1147510621 17:41065825-41065847 GCCGCAGCAGGAGCCGGTCATGG + Exonic
1147613153 17:41813064-41813086 GCAGCAGGGGGAGCCGGAGGAGG - Exonic
1147793083 17:43025292-43025314 GCGGCGGCGGGGCCCGGGAGAGG + Exonic
1147996760 17:44363811-44363833 GCCGCAGCGGGAGCGGGAGCCGG - Exonic
1148262218 17:46193486-46193508 GCCGCAGCCGCAGCCGGCGGAGG - Intronic
1148323505 17:46771103-46771125 GCGGCCGCGGGAGCCAAGAGGGG - Intronic
1148652531 17:49260305-49260327 GCAGCCGCGTGGGCCGGGAGGGG - Intergenic
1148733427 17:49851376-49851398 GCCCCCGCGGGAGCCGGGCCGGG + Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1148782712 17:50130487-50130509 GCCGCGGCGGGAGCTGGGCTGGG + Intergenic
1148788832 17:50161585-50161607 GACGGAGCGGGAGTCGGGGGCGG - Intergenic
1149682858 17:58517857-58517879 GCAGCTGCGGGAGACGGAAGTGG - Exonic
1150239833 17:63622595-63622617 GCCGGAGCCGGAGCCTGGGGAGG + Exonic
1152111562 17:78359984-78360006 GCCGCGGCGGGAGCTGGGCCGGG + Exonic
1152190346 17:78884138-78884160 GAGGCAGAGGGAGCCTGGAGAGG + Intronic
1152339404 17:79716015-79716037 GGCTCAGCAGAAGCCGGGAGAGG + Intergenic
1152396262 17:80035649-80035671 GCAGCCGCGGGACCGGGGAGGGG - Intronic
1152579696 17:81160462-81160484 CCCGCAGAGGAAGCCGGCAGAGG - Intronic
1152587288 17:81194706-81194728 GCCGCAGCGGAGGCCGTGACGGG + Intronic
1152616689 17:81341264-81341286 GCGGCATCGGGAGCCAGGCGTGG - Intergenic
1152654957 17:81515031-81515053 GTCGGGGCGGGAGCCGGGCGTGG + Intronic
1152730347 17:81966950-81966972 GCAGCAGCTGGAGCCCAGAGCGG - Intergenic
1152800572 17:82328882-82328904 GCTGCACTGGGAGCTGGGAGAGG - Intronic
1153489142 18:5630057-5630079 GCTGCCGCGGAAGCCGGGCGCGG - Intronic
1153794396 18:8609480-8609502 GCCGCCGCCGCCGCCGGGAGAGG - Exonic
1154507880 18:15060651-15060673 GCTGCAGCTGCACCCGGGAGTGG - Intergenic
1155392478 18:25351079-25351101 GCCGGAGCCGGAGCGAGGAGCGG - Intronic
1156149213 18:34223364-34223386 GCCGCAGCGGGAGCCTGCTTTGG + Exonic
1157097223 18:44696968-44696990 GCGGCAGTGGGGGCTGGGAGTGG - Intronic
1160204653 18:76822738-76822760 GGCGCGGGGGGCGCCGGGAGCGG + Intronic
1160623114 18:80184577-80184599 CCCGCAGCGGGAGCGAGGCGCGG + Intronic
1160682805 19:419541-419563 CCACCAGCGGGCGCCGGGAGGGG + Intronic
1160788697 19:913046-913068 GGCGCGGCGGGCGCCGGGGGCGG - Intronic
1160861059 19:1237410-1237432 GCGGCTGCGGGAGCCGAGGGCGG + Intronic
1160861277 19:1238098-1238120 GCCGCGGCGGGTGCGGGGGGCGG - Intergenic
1161038125 19:2096606-2096628 GCCTCAGCGGGAGCCGGCCGAGG + Intronic
1161108781 19:2456974-2456996 GCCGCGGCGGGCGGCGGGCGCGG - Exonic
1161150078 19:2702804-2702826 GCCGGAGCGGGGGCGGGGCGCGG + Intergenic
1161331839 19:3692310-3692332 GCCGTGGTGGGAGCCGGCAGTGG - Intronic
1161349574 19:3784451-3784473 TCTGCAGAGGGGGCCGGGAGAGG + Exonic
1162393448 19:10403328-10403350 TCCGAAGCGGGGTCCGGGAGTGG + Intronic
1163243071 19:16076244-16076266 GCCGCAGGGGGAGGAGGAAGAGG + Intronic
1165459508 19:35936453-35936475 GCCGAGGCGGGGGCCGGGCGGGG - Intronic
1165775750 19:38403443-38403465 GCAGCAGCGAGAGGCGGGCGCGG + Exonic
1165866581 19:38943043-38943065 GGAGGAGAGGGAGCCGGGAGGGG + Intronic
1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG + Exonic
1165939862 19:39409703-39409725 GGGGCCGCGGGAGGCGGGAGGGG + Intergenic
1166228761 19:41413452-41413474 GTAGCAGAGGGAGGCGGGAGAGG - Intronic
1166894694 19:46016167-46016189 GCGGCCGCGGGAGCCGGGGTCGG + Exonic
1167080831 19:47275169-47275191 GCAGCGGCGGGCGCCGGGACAGG - Exonic
1167375322 19:49108001-49108023 GAAGCAGCCGGAGTCGGGAGCGG + Exonic
1168332745 19:55579444-55579466 GGCTCAGCCGGTGCCGGGAGAGG + Exonic
1168347774 19:55659276-55659298 GCCGGAGCCGGAGCCGCGACCGG + Exonic
1168528515 19:57106903-57106925 GGCGCAGGCGGAGCCCGGAGAGG + Intergenic
925068858 2:950868-950890 GCCCGAGCCGGAGCCGGCAGAGG + Exonic
925370294 2:3339983-3340005 GCCGAAGCAGGAGCTAGGAGAGG - Intronic
925610250 2:5696361-5696383 GCCGCAGGGGGCGCGGGGCGCGG + Exonic
926189957 2:10721288-10721310 GCCGCAGCGGGAGGGCGGGGTGG + Intergenic
926219089 2:10923242-10923264 GCGGCACCCAGAGCCGGGAGAGG + Intergenic
927472274 2:23385406-23385428 GCCGCCGCGGCTGCGGGGAGAGG + Exonic
927830419 2:26345626-26345648 ACCGCACCAGGAGCTGGGAGCGG + Intronic
930762231 2:55049795-55049817 GGCGCGGCGGGAGCCGGGGCTGG + Exonic
931671802 2:64654074-64654096 GCCGCAGGAGGAGCAGGAAGGGG + Intronic
932413422 2:71560294-71560316 CCCGGGTCGGGAGCCGGGAGGGG - Intronic
934933214 2:98445119-98445141 GCCGCCGCGGGGGCCGGGGCCGG + Intronic
935349685 2:102142696-102142718 GCCGCTGCGGGGGCGGGGAACGG - Intronic
937214430 2:120302453-120302475 GCCGCAGAAGGAGCTGTGAGGGG - Intergenic
938322060 2:130372327-130372349 GCTCCAGCGGGCGCCGGGAGTGG + Exonic
938536450 2:132252996-132253018 GCCGCAGGGGGAGGGGGAAGGGG + Intronic
940650356 2:156435648-156435670 CCCGCCGGGGGAGCCGGGCGAGG + Exonic
942452416 2:176116502-176116524 GCCGAAGCGGGGGACGCGAGTGG + Intronic
945102505 2:206274953-206274975 GCCGCGGCGGGGGCGGGGCGCGG + Intronic
946321984 2:218959773-218959795 GCCCCAGCGGGAGCCGCGGGCGG - Exonic
946372552 2:219289814-219289836 GAAGCAGGGGGAGCCGGGTGTGG + Exonic
946843243 2:223837785-223837807 GCCGAGGCGGGGGCGGGGAGGGG - Intronic
947117943 2:226791673-226791695 GCCGCGGCGGGCGCGGGGCGGGG - Intronic
947669337 2:231926494-231926516 GCCGCGCCGAGGGCCGGGAGGGG + Intergenic
948586112 2:239020769-239020791 GCCCCAGAGGGAGGCAGGAGGGG - Intergenic
948751709 2:240136820-240136842 GCCGGGGCGGGAGACGGGGGGGG + Intergenic
948797677 2:240413076-240413098 GCCTCAGCGGGAGCCAGGTGAGG - Intergenic
948856965 2:240734787-240734809 AGCGCAGCGGGAGCGGGGTGGGG + Intronic
1172436235 20:34930808-34930830 GCTGGAGGGGGAGCTGGGAGGGG - Intronic
1172528806 20:35616978-35617000 GGCGGAGCTGGAGCCGGGATAGG + Intronic
1172773127 20:37393025-37393047 GCCTGGGCGGGAGCGGGGAGGGG - Intronic
1173516221 20:43667216-43667238 CCCGGAGCGGGAGCCGGGCCGGG - Exonic
1173576555 20:44115994-44116016 GCCGTCGCGGGAGCCGGAGGTGG - Exonic
1173820161 20:46014281-46014303 GCCGCCGCGGCCGCCGGCAGGGG + Intronic
1174287763 20:49484185-49484207 GCCGCCGCGGGAGCAGGAGGAGG - Intergenic
1174804722 20:53594604-53594626 GCCGCGGCGGTAGCCGTGACAGG + Intronic
1175541461 20:59750644-59750666 GCTGCTGCGGGAGCCTGGGGCGG + Intronic
1176008456 20:62879575-62879597 GCCGAAACTGGAGCCGAGAGCGG - Exonic
1176143259 20:63554228-63554250 GCGGCGGCGGGGGCCGGGAGAGG + Exonic
1176187764 20:63790700-63790722 CCCGCAGCAGGTGCCGGTAGTGG + Exonic
1176790202 21:13311148-13311170 GCTGCAGCTGCACCCGGGAGTGG + Intergenic
1178073329 21:28992958-28992980 GACACAGCGGGAGGCGGGAGCGG - Intergenic
1178298397 21:31429916-31429938 TGCACAGGGGGAGCCGGGAGTGG + Intronic
1178453666 21:32727829-32727851 GCGTCAGCGGGAGCGGTGAGGGG - Intronic
1178680799 21:34670474-34670496 GCCACAGCAGGAGCCGGGGGAGG + Exonic
1178992583 21:37367549-37367571 GCCGCGGCGGGAGCGCGGCGCGG + Intronic
1179606827 21:42521999-42522021 GCAGCAGCAGGAGCTGGAAGAGG - Intronic
1179626831 21:42653741-42653763 GCCGCCGCGGGAGGCGGGGGAGG - Exonic
1179779309 21:43689195-43689217 GCTGCAGCGGCAGAGGGGAGTGG + Intronic
1180559206 22:16601912-16601934 GCAGCAGCAGGTACCGGGAGAGG - Intergenic
1180635061 22:17257466-17257488 GCCTCTGGGGGAGGCGGGAGAGG + Intergenic
1180636277 22:17265146-17265168 TCCACGGCTGGAGCCGGGAGCGG - Intergenic
1180959230 22:19755222-19755244 GCGGGAGCGGGAGCCGGCACGGG - Intergenic
1181680841 22:24494954-24494976 GCCCCTGAGGGAGGCGGGAGGGG + Intronic
1182251608 22:29005155-29005177 GCAGCAGCGAGTGCTGGGAGGGG - Intronic
1182372288 22:29819721-29819743 GCAGCAGCAGGAGACGGGGGAGG - Intronic
1183352612 22:37342562-37342584 GCAGCAGTGGGACCCAGGAGTGG - Intergenic
1183535689 22:38399149-38399171 GCCGCGGCGGTAGCCGTGACAGG + Intergenic
1183579743 22:38716855-38716877 GCCACGGCGGCAGCCTGGAGTGG + Exonic
1183647432 22:39134651-39134673 TCGGCAGCGGGAGCCCTGAGGGG - Exonic
1184327183 22:43797820-43797842 GAGGCAGAGGGAGCCGGGGGAGG - Intronic
1184677793 22:46053185-46053207 GCCACAGCAGGGGCTGGGAGGGG - Intronic
1185331680 22:50254848-50254870 GGCACAGAAGGAGCCGGGAGTGG - Intronic
950060662 3:10069486-10069508 GCATCAGAGGGAGACGGGAGAGG - Intronic
950811229 3:15651630-15651652 GCCGCAGCAGGAGTCAGGAGCGG - Intergenic
951793714 3:26515482-26515504 GCAACAGAGGGAGACGGGAGAGG - Intergenic
954662202 3:52232148-52232170 GGCGCAGTGGGAGCTGGGAGCGG - Intronic
956675003 3:71725229-71725251 GCTGCAGCCTGAGCCGGGCGGGG - Exonic
956750412 3:72340251-72340273 GCCCCAGGGGGGGCCGGGTGTGG - Intergenic
956761204 3:72446898-72446920 GCCGCGGCGGGCGCAGGAAGCGG + Exonic
957459459 3:80497747-80497769 CCCACAGCGGGTGCTGGGAGAGG + Intergenic
960280873 3:115780318-115780340 ACAGCAGTGGGGGCCGGGAGCGG + Intergenic
960684730 3:120285172-120285194 GCCGCGCCGGGAGCCTGGCGTGG + Intergenic
961081605 3:124033163-124033185 GAGGGAGCGGGAGCCGGGGGAGG + Intergenic
961296136 3:125886207-125886229 CCCACAGCAGGAGCCGGGAATGG - Intergenic
961650048 3:128412792-128412814 GCAGCAGTGGGTGCTGGGAGTGG + Intergenic
961663566 3:128482984-128483006 GCAGCCGCGGGGGCAGGGAGGGG + Intronic
961889662 3:130119967-130119989 CCCACAGCAGGAGCCGGGAATGG + Intergenic
968452453 4:681780-681802 GCGGGAGGGGGAGCGGGGAGGGG - Intronic
968726882 4:2251952-2251974 GGGGCAGCGGGAGCTGGCAGTGG - Intronic
968967851 4:3778344-3778366 GCAGCAGCAGCAGCTGGGAGCGG + Intergenic
969583866 4:8080887-8080909 GCCCCTGGGGCAGCCGGGAGGGG + Intronic
980731010 4:136824196-136824218 ACTGGAGCGGGAGCTGGGAGTGG + Intergenic
983923400 4:173371103-173371125 GCCGCTGCCGGAGCGGAGAGAGG + Exonic
984639295 4:182144613-182144635 CCCGCCGAGGGAGCGGGGAGCGG - Intronic
985729234 5:1537976-1537998 GGGGCGGCGGGAGCTGGGAGAGG - Intergenic
985773586 5:1828017-1828039 GCCGCAGCGGGAGCCGGAGCAGG + Intergenic
985996795 5:3601405-3601427 ACAGCAGCAGGAGCGGGGAGGGG - Intergenic
991298167 5:65103024-65103046 GCCTCGGCGGCCGCCGGGAGCGG + Intergenic
992828339 5:80570521-80570543 GCCGAAGCGGGGGACGGGGGTGG - Intergenic
992939691 5:81750597-81750619 GCCGCCGGGGGTGGCGGGAGGGG - Intronic
995344147 5:111092324-111092346 TTCGCAGCGGGCGCCGGAAGCGG + Exonic
997584003 5:135034145-135034167 GCCGGAGCCGGAGCCGGGGCCGG - Exonic
998140891 5:139698817-139698839 GGAGCAGAGGGAGCAGGGAGGGG - Intergenic
998328570 5:141303941-141303963 GCCGCAGCGAGCGCGGGGAATGG + Intergenic
998406274 5:141876378-141876400 GGCGCAGCGGGCGCCAGGAGGGG + Intronic
998957640 5:147453733-147453755 GCCGCCGCGGGAGCCCGGGAGGG - Intronic
1001936593 5:175709888-175709910 GGCGCAGGGGGAGGCTGGAGAGG - Intergenic
1002394453 5:178941980-178942002 GCCGCAGAGGGAGAGCGGAGCGG + Intronic
1002439631 5:179257561-179257583 GCATCAGCGGGAGCCAGCAGCGG - Intronic
1002487649 5:179550620-179550642 GCCGGAGCTGGAGCCGGGGCCGG + Exonic
1002718866 5:181246172-181246194 TCCACAGCGGGAGGCGGGTGTGG - Intronic
1002844707 6:936278-936300 GCCTGTGCGGGGGCCGGGAGGGG - Intergenic
1002898000 6:1390182-1390204 GGCGGCGCGGGCGCCGGGAGCGG + Exonic
1002926925 6:1610278-1610300 GCCCCAGCGAGCGCCGGGAGAGG + Exonic
1003942554 6:11043965-11043987 GCCGGGGCGGGACCGGGGAGAGG + Intronic
1005040683 6:21596729-21596751 GCAGCAGCGGGAGCTAGGGGCGG + Exonic
1005826245 6:29633062-29633084 GCAGCCACGGGAGCGGGGAGCGG + Exonic
1005940300 6:30555665-30555687 GCCGCAGCGGGAGCCGGGAGCGG - Exonic
1005968681 6:30744379-30744401 GCCGCTGCGGGCTCCGGGAGAGG + Exonic
1006449844 6:34099530-34099552 GCAGCAGAGGGAGCAGGGTGGGG + Intronic
1006581806 6:35081705-35081727 GCTGGAGCGGGCACCGGGAGCGG - Intronic
1006637181 6:35469080-35469102 GGCTCAGCGGGAGCCTGCAGGGG - Intronic
1006725511 6:36196817-36196839 GCCCCAGCGCGGGCCGGGAGGGG + Exonic
1007075258 6:39062139-39062161 GCCGCAGCAGCTTCCGGGAGGGG + Intronic
1007363731 6:41375679-41375701 CCCGGAGCGGGAGCCGGGGCGGG + Intergenic
1007431494 6:41779846-41779868 GCTGCAGCGGGACCCGGGAGCGG - Exonic
1007673482 6:43575957-43575979 GCCGCGGCGGGCGGCGGGGGTGG + Exonic
1007701969 6:43770973-43770995 GCCGCAGCCGGAGGAGGGGGAGG + Exonic
1010184963 6:73133586-73133608 GGCGCAGCGAGGGCCGGAAGCGG - Exonic
1012111040 6:95234072-95234094 GCCAAAGCGGGAGCCAGCAGTGG - Intergenic
1013117467 6:107114439-107114461 GCGGCGGCGGCGGCCGGGAGCGG - Intronic
1013117504 6:107114561-107114583 GTCGGAGCGGGAGCAGGGGGCGG - Intronic
1013279430 6:108621960-108621982 GAAGCAGGGGCAGCCGGGAGTGG + Intronic
1014045324 6:116877510-116877532 GCCGCATCCGGAGCTGGGAAGGG + Intronic
1015625790 6:135180585-135180607 GCGGCTGCAGGATCCGGGAGGGG + Intergenic
1016447775 6:144150571-144150593 GCCGCAGGAGGCGCCGGGAGCGG + Exonic
1016785867 6:148010501-148010523 GCCACAGCTGGAGCTGGGAGTGG - Intergenic
1018778995 6:167045350-167045372 GCCGCGGGGGGGGCGGGGAGGGG - Exonic
1019276472 7:178511-178533 GCCGCATCTGGGGCCGTGAGGGG - Intergenic
1019343664 7:519760-519782 GCCGCAGCCGCCGCCGGGAGAGG + Intronic
1019614999 7:1955248-1955270 GAGGGAGCGGGAGCAGGGAGAGG + Intronic
1020178103 7:5898809-5898831 GCGGCGGCCGGGGCCGGGAGCGG + Exonic
1020304824 7:6826166-6826188 GCGGCGGCCGGGGCCGGGAGCGG - Exonic
1022410377 7:30135107-30135129 GCGGCGGCGGGAGGCGGGCGCGG + Exonic
1022479705 7:30734733-30734755 GCAGCAGAGGGAGCTAGGAGAGG - Intronic
1022498074 7:30865634-30865656 GCCTCAGCGGGAGCTGGAGGTGG + Intronic
1024613228 7:51084905-51084927 ACGGCTGCAGGAGCCGGGAGAGG - Intronic
1025608173 7:63054316-63054338 GCGGCAGAGGGAGCGGGGAGCGG - Intergenic
1026968299 7:74453935-74453957 GCCGCAGCCCGCGCCGGGGGTGG + Intronic
1027138237 7:75639297-75639319 GCCGCAGCGCGCGCCGGGGGCGG + Intronic
1027361770 7:77416518-77416540 GCCGGAGCCGGAGCCGGGCACGG + Intergenic
1028567165 7:92246093-92246115 GCCGGAGCCGGAGCCGGAGGCGG + Exonic
1028567170 7:92246099-92246121 GCCGGAGCCGGAGGCGGGGGAGG + Exonic
1029258893 7:99287930-99287952 GCTGCGGCGGGAGCTGGAAGAGG + Intergenic
1029285864 7:99465799-99465821 GTCGCAGCGGGAGAGGGAAGCGG + Intronic
1029640422 7:101816440-101816462 GCCGCCGCGGGACCGGGGAGGGG + Intronic
1029640462 7:101816528-101816550 GCGGCGGCGGGCGCCGGGAGGGG + Intronic
1034455506 7:151167828-151167850 GAGGGAGCGGGAGCCGGGCGCGG - Intronic
1034483616 7:151341996-151342018 GCCGGGGCCGGGGCCGGGAGCGG + Intronic
1034488097 7:151378907-151378929 GCCGCAGAGGAAGCCGGCTGTGG + Intronic
1034618043 7:152435923-152435945 GCAGCAGCAGGTACCGGGAGAGG + Exonic
1034911667 7:155002981-155003003 GGCGCCGCGGGGGCCGGGGGCGG - Exonic
1035205769 7:157292992-157293014 GCCTCACCGGGCGCTGGGAGGGG - Intergenic
1035234770 7:157489138-157489160 GCAGCAGCAGAGGCCGGGAGAGG + Intergenic
1035680695 8:1485623-1485645 CCCACAGTGGGAGCTGGGAGGGG - Intergenic
1037226785 8:16602240-16602262 GACGGATCGGGAGCCAGGAGGGG - Intergenic
1037886777 8:22599695-22599717 GCCGGGGCCGGGGCCGGGAGCGG + Exonic
1037961629 8:23102482-23102504 GCCGCTGTGGGAGGAGGGAGTGG + Intronic
1037969897 8:23164439-23164461 GCCGCTGTGGGAGGAGGGAGTGG - Intergenic
1038283947 8:26190355-26190377 ACGACAGCGGGAGCCGGGCGTGG + Intergenic
1042004845 8:64169122-64169144 GCAGGTGCGGGAGCAGGGAGAGG - Intergenic
1044999696 8:97869012-97869034 GCCGCGGCGGGGGTGGGGAGCGG - Intronic
1049651506 8:143771866-143771888 GGCGCAGCGGGAGCGGCGGGAGG + Intergenic
1049654249 8:143790808-143790830 GGCGCAGCGGGAGACGTGGGAGG + Intergenic
1049680609 8:143916309-143916331 GCCGCGGCGGGAGCCGGCCCGGG + Exonic
1049688548 8:143949013-143949035 GCCGCAGAGAGAGCCAGGAGGGG + Intronic
1050410881 9:5363523-5363545 GCCGCTGAGGGAGACGGAAGTGG + Intronic
1051170108 9:14313312-14313334 GGCGGCGTGGGAGCCGGGAGCGG - Intronic
1051855495 9:21559886-21559908 GCTGGAGCGGGAGCCGGGGGCGG - Intergenic
1053055190 9:34989760-34989782 GGCGGAGCCGGAGCCGGGGGAGG + Exonic
1053569364 9:39288243-39288265 GACGCAGCTGGGGCCGGGCGCGG - Intronic
1053835323 9:42129285-42129307 GACGCAGCTGGGGCCGGGCGCGG - Exonic
1054090993 9:60847227-60847249 GACGCAGCTGGGGCCGGGCGCGG - Intergenic
1054112404 9:61122783-61122805 GACGCAGCTGGGGCCGGGCGCGG - Intergenic
1054127781 9:61330767-61330789 GACGCAGCTGGGGCCGGGCGCGG + Intergenic
1054595301 9:67059346-67059368 GACGCAGCTGGGGCCGGGCGCGG + Intergenic
1054787193 9:69221131-69221153 GCCGTGGCCGGAGCCTGGAGCGG + Exonic
1054787209 9:69221191-69221213 GCCGTGGCCGGAGCCTGGAGCGG + Exonic
1056475290 9:86946785-86946807 GCAGCGGCGGCCGCCGGGAGAGG + Exonic
1057881560 9:98796392-98796414 GCGGCTGCTGGAGCCGGGGGCGG - Exonic
1060409362 9:123389944-123389966 GCCGCAGGGGAGGCCAGGAGAGG - Intronic
1060477936 9:123999657-123999679 GCGGCGGCGAGCGCCGGGAGGGG - Intergenic
1060554258 9:124500248-124500270 GCTGCAGCTGGAGCCGGATGAGG - Exonic
1060825103 9:126683281-126683303 GCGGCGGCGGGAGCCGCGGGCGG - Intronic
1061285826 9:129621930-129621952 GGCCCAGAGGCAGCCGGGAGGGG - Intronic
1061802836 9:133121392-133121414 GCGGGACCGGGAGCCTGGAGGGG + Intronic
1062022473 9:134326106-134326128 GGCGCAGAGGGAGCGGGGCGGGG - Intronic
1062243866 9:135553342-135553364 GACGCAGAGGGAGCTGGGAAGGG - Intergenic
1062261603 9:135665772-135665794 GACCAAGCGGGAGCCGGGACAGG + Intronic
1062284018 9:135765180-135765202 GCCTCACCTGGAGCCGGGGGTGG - Exonic
1062413727 9:136437714-136437736 GCCGCGGCGGGAGGCAGGACAGG - Intronic
1062507733 9:136886651-136886673 GCCGGAGCGGGAGCGGGGGCGGG + Intronic
1186509028 X:10116926-10116948 GCCCCAGTGGGAGCCCAGAGGGG + Intronic
1186513178 X:10146489-10146511 GCAGCAGCAAGAGCCGGAAGAGG - Intergenic
1189309324 X:40008916-40008938 GGGGCAGCGGGAGCCGCGGGAGG - Intergenic
1189915559 X:45851775-45851797 GCCGCCGCGGGCCCCAGGAGTGG - Intergenic
1190881627 X:54495931-54495953 GCCGCAGCCGAGGCCGGGGGCGG + Exonic
1192350312 X:70350462-70350484 GCAACAGAGGGAGACGGGAGAGG + Intronic
1196563035 X:117173512-117173534 GCCCCAGCCCGAGCTGGGAGGGG - Intergenic
1196669099 X:118346653-118346675 GACACAGCGGGACCTGGGAGGGG - Intronic
1199649759 X:149939647-149939669 GCCGCAGGAGGAGCCGGGTGGGG + Intergenic
1200229395 X:154436756-154436778 GCCGCTGCGGCAGCCTGGGGCGG - Intergenic
1200239404 X:154486044-154486066 GCCGCCTCGGGCGGCGGGAGCGG + Intronic