ID: 1005941346

View in Genome Browser
Species Human (GRCh38)
Location 6:30562551-30562573
Sequence ATTTCTCTGTAGCCCTATGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005941341_1005941346 20 Left 1005941341 6:30562508-30562530 CCATCCAGGCTGGAAGGAGCTCT 0: 1
1: 0
2: 6
3: 28
4: 226
Right 1005941346 6:30562551-30562573 ATTTCTCTGTAGCCCTATGATGG 0: 1
1: 0
2: 0
3: 14
4: 242
1005941344_1005941346 -9 Left 1005941344 6:30562537-30562559 CCTAGCGGCCATTTATTTCTCTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1005941346 6:30562551-30562573 ATTTCTCTGTAGCCCTATGATGG 0: 1
1: 0
2: 0
3: 14
4: 242
1005941340_1005941346 21 Left 1005941340 6:30562507-30562529 CCCATCCAGGCTGGAAGGAGCTC 0: 1
1: 0
2: 2
3: 22
4: 183
Right 1005941346 6:30562551-30562573 ATTTCTCTGTAGCCCTATGATGG 0: 1
1: 0
2: 0
3: 14
4: 242
1005941342_1005941346 16 Left 1005941342 6:30562512-30562534 CCAGGCTGGAAGGAGCTCTCTGT 0: 1
1: 0
2: 4
3: 35
4: 286
Right 1005941346 6:30562551-30562573 ATTTCTCTGTAGCCCTATGATGG 0: 1
1: 0
2: 0
3: 14
4: 242
1005941339_1005941346 25 Left 1005941339 6:30562503-30562525 CCTTCCCATCCAGGCTGGAAGGA 0: 1
1: 0
2: 4
3: 30
4: 343
Right 1005941346 6:30562551-30562573 ATTTCTCTGTAGCCCTATGATGG 0: 1
1: 0
2: 0
3: 14
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005941346 Original CRISPR ATTTCTCTGTAGCCCTATGA TGG Exonic
900795390 1:4704891-4704913 ATTTCTCTGATGGCCAATGATGG + Intronic
903801960 1:25975542-25975564 CTTGCTCTGTTGCCCTATGCTGG - Intronic
905422661 1:37859277-37859299 TTTTCTGTGTAGCCCTGTGCTGG - Intronic
908869823 1:68596683-68596705 AATTCTCTTCAGTCCTATGAAGG + Intergenic
909393294 1:75138662-75138684 GTTTCTGAGTAGACCTATGAAGG + Intronic
911842529 1:102702308-102702330 ATTTCTCTGATGGCCAATGATGG - Intergenic
912146071 1:106795978-106796000 CCTTCTCTGTCACCCTATGAGGG + Intergenic
913028080 1:114866418-114866440 ATTTCTCTGATGACATATGATGG + Intronic
913412547 1:118568967-118568989 ATTTCTCTGTTGGCCAGTGATGG + Intergenic
914979555 1:152400936-152400958 ATTTCTCTGATGGCCTGTGATGG + Intergenic
914986789 1:152464910-152464932 ATTTCTCTGATGGCCTGTGATGG + Intergenic
916264830 1:162880527-162880549 ATTTCTCTGATGGCCTGTGATGG + Intergenic
916918729 1:169439320-169439342 GTCTCTCTGTAGCCCCATGGTGG - Intronic
918941114 1:190998891-190998913 ATTTCTCTGAAGACCAATCATGG - Intergenic
920590366 1:207212152-207212174 ATTTCTCTGATGGCCAATGATGG - Intergenic
920984316 1:210871308-210871330 ATTTCTCTGTTGGCCAGTGATGG - Intronic
921038192 1:211403026-211403048 ATTTCTCTGATGGCCAATGATGG + Intergenic
921630854 1:217432109-217432131 CTATCTCTGGAGGCCTATGAAGG - Intronic
924648078 1:245898041-245898063 AATTCACAGTAGCCCTAAGAAGG - Intronic
1063618838 10:7626261-7626283 TTTTCTCTGTAGCCCAATACCGG - Intronic
1063899797 10:10720501-10720523 CTTTATCTGTGGCCCTATGTTGG + Intergenic
1064277912 10:13924144-13924166 CTGTCTCTGTTGCCCAATGAGGG + Intronic
1065008905 10:21404191-21404213 TTCTTTCTGTAGCCCTAAGATGG + Intergenic
1066786659 10:39011817-39011839 ATTTCTCTGATGGCCAATGATGG - Intergenic
1067400440 10:45968555-45968577 CTTTCTCTGAGGCCCTAAGAAGG - Intergenic
1067868760 10:49937857-49937879 CTTTCTCTGAGGCCCTAAGAAGG - Intronic
1068084728 10:52360931-52360953 ATTTCTCTGATGGCCAATGATGG + Intergenic
1068510612 10:57961005-57961027 ATTTCTCTGTGGCACTGTAATGG + Intergenic
1072010164 10:91296052-91296074 ATTTTTCTGTGGCTCTATGCAGG - Intergenic
1073924418 10:108498441-108498463 ATTTCTCTGTTGGCCAGTGATGG - Intergenic
1076856837 10:133120615-133120637 AACTCTCTTTAACCCTATGATGG - Intronic
1077519260 11:3022047-3022069 AATTCTCATTAACCCTATGAGGG - Intronic
1077847308 11:6039564-6039586 ATCTGTCTGTAGCCCCATGGTGG + Intergenic
1077970087 11:7180442-7180464 ATTTCTCTGAAGGCCAGTGATGG - Intergenic
1078298498 11:10100717-10100739 GTTTTTCTGTAGCCCCATGGTGG + Intronic
1078752285 11:14176513-14176535 GGGTGTCTGTAGCCCTATGATGG - Intronic
1079283072 11:19105356-19105378 ATTTCTATGGTGCCCTCTGAAGG + Intergenic
1079702709 11:23568956-23568978 ATTTCTATGTAGCCTTATTAAGG + Intergenic
1079749889 11:24184276-24184298 ATTTCTCTGTTGGCCAGTGATGG - Intergenic
1079827377 11:25214084-25214106 ATTTCTTCGTAGCAGTATGAGGG + Intergenic
1080117269 11:28634984-28635006 ATTACTAAGTAGCCTTATGATGG + Intergenic
1081800054 11:45852316-45852338 ATTTCTCTTTACTCCAATGAGGG - Intronic
1083019612 11:59493470-59493492 ATTTCTCTGATGGCCAATGATGG - Intergenic
1085023567 11:73223759-73223781 ATGTCTCTGTAGCCCTGTTCTGG + Intronic
1087722894 11:101687058-101687080 ATTTCACTGGAGCCCTGTGTAGG - Intronic
1087738165 11:101857887-101857909 ATTTCTCTGATGGCCAATGATGG - Intronic
1087832958 11:102839433-102839455 ATTACTCTGGAAACCTATGACGG - Intronic
1088007599 11:104961464-104961486 ACTTGTCTGTAGCTCTATGATGG + Intronic
1088896072 11:114079314-114079336 ATTGCGCTGTAGCCCTGTTATGG + Intronic
1095139393 12:38643058-38643080 ATTTCTATGAAGCAATATGAAGG - Intergenic
1095468867 12:42515690-42515712 ATTTCTCTTTAGAACTTTGAGGG + Intronic
1095989158 12:48022333-48022355 ATTTATATGTAGACTTATGAAGG + Intronic
1096750070 12:53752906-53752928 ATGACTCTGCAGCCCTAAGAGGG - Intergenic
1101563629 12:105883733-105883755 ATTTGTGTGTAGCTCTTTGAAGG - Intergenic
1103426244 12:120837271-120837293 ATTTCTCTCTAGCCAGTTGAAGG - Intronic
1103451343 12:121031508-121031530 ATTTCTCTGCAGCTCGCTGAAGG + Exonic
1106756412 13:32826913-32826935 GTCTCTCTGTAGCCCCATGGGGG + Intergenic
1107327555 13:39261398-39261420 ATTTCACTGTAGCACTCTGTAGG - Intergenic
1107337185 13:39367770-39367792 ATTTCTCTGAAGCCTACTGATGG + Intronic
1109469910 13:62791140-62791162 CTGTTTCTGTAGCCCTATCATGG - Intergenic
1112690532 13:101888585-101888607 CTTACTCTGTTGCCTTATGATGG + Intronic
1113323784 13:109264393-109264415 AATTCTCTGAAGCCATGTGAAGG - Intergenic
1115510939 14:34137321-34137343 ATTTCACTGTCTCCCTATTATGG + Intronic
1116306025 14:43257139-43257161 ATTTCTCTGTTGGCCAGTGATGG - Intergenic
1116330974 14:43597450-43597472 TTTTGTCTATTGCCCTATGAAGG + Intergenic
1116405637 14:44562516-44562538 ATGTCTCTGTATCCCTGGGAAGG + Intergenic
1117497908 14:56323907-56323929 TGTTCTTTCTAGCCCTATGATGG - Intergenic
1119984932 14:79126909-79126931 ATTTCTCTGTTGGCCAGTGATGG + Intronic
1120794202 14:88614096-88614118 ATTTCTCTGTAGCCAAAAGCTGG + Exonic
1120933503 14:89871943-89871965 ATCCCACTGCAGCCCTATGACGG + Intronic
1123222571 14:106870863-106870885 ATTCCTGGGTAGCCCGATGAGGG + Intergenic
1125095489 15:35845600-35845622 ATATCTCTGTGGCACTAGGATGG - Intergenic
1125714275 15:41810357-41810379 CTATCTCTGTAGCCCCATGAGGG - Intronic
1126073002 15:44882438-44882460 GTTTGTCTGTAGCCCCATGGTGG - Intergenic
1126085252 15:45005219-45005241 GTTTGTCTGTAGCCCCATGGTGG + Intergenic
1127577078 15:60302243-60302265 ATTTCTCTGATGCCCAGTGATGG + Intergenic
1127874715 15:63102179-63102201 ATTTCTCTGATGCCCAGTGATGG + Intergenic
1131750967 15:95507748-95507770 ATTTCTCTGTATCCATAAAATGG - Intergenic
1131920592 15:97323803-97323825 ATTTCTCTTTAGCTCTCAGAGGG + Intergenic
1132020301 15:98355601-98355623 ATGTCTCTGTAGGCCTAAAAAGG - Intergenic
1133082206 16:3331121-3331143 ATTTCTCTGATGGCCAATGATGG + Intergenic
1135905673 16:26509665-26509687 ATTTCCCTGGAGCACTTTGAAGG + Intergenic
1136287552 16:29253365-29253387 CTTTCTCTGCAGCCCCAGGATGG + Intergenic
1136585014 16:31179335-31179357 ATTTTTCTGAAGCCCTACCAGGG - Intergenic
1142093172 16:88225994-88226016 CTTTCTCTGTAGCCCCAGGATGG + Intergenic
1142520634 17:502290-502312 ATTTCTCTGTATCTGTATGTGGG - Intergenic
1143489958 17:7280636-7280658 ATGTCACTGAAGCCCTATGGTGG + Intergenic
1143753523 17:9049620-9049642 ATTACTCTTTAGGACTATGAAGG + Intronic
1144425302 17:15135643-15135665 ATTTTTCTTTAGCCCTTAGATGG - Intergenic
1145308431 17:21688218-21688240 TTTCCTCTGTAGCCCTATATGGG - Intergenic
1145408476 17:22632759-22632781 ATTTCTCTGATGCCCAGTGATGG + Intergenic
1146752987 17:35399200-35399222 ATTTCTCTGTTGGCCAGTGATGG - Intergenic
1146957578 17:36945619-36945641 ATTTCACTGCATCCATATGATGG + Intergenic
1149036452 17:52139802-52139824 TTTTATCTCTAACCCTATGAGGG - Intronic
1150866714 17:68858293-68858315 AATTCTCTGTAGTTCTGTGAAGG + Intergenic
1151120801 17:71790628-71790650 ATTACTTTGTAGTCTTATGAGGG - Intergenic
1153462891 18:5356237-5356259 ATTTGTGTGTAGCCCAAGGATGG + Intergenic
1153563283 18:6393887-6393909 AGTGCTCTGTAGCCACATGAGGG - Intronic
1153582724 18:6591217-6591239 TCTTCTCAGTAACCCTATGAAGG + Intergenic
1154009482 18:10562990-10563012 TTTTCTCACTAGCGCTATGAGGG - Intergenic
1154478246 18:14789128-14789150 ATTTCTCTGATGGCCAATGATGG + Intronic
1154942034 18:21123564-21123586 ATTTATCTCTAGAACTATGAGGG - Intergenic
1156141815 18:34121519-34121541 CTTTCTCTGTCTCCCTAAGATGG - Intronic
1156726446 18:40134079-40134101 ATGTATCAGTAGCTCTATGATGG - Intergenic
1156879987 18:42065652-42065674 ATTTCCCTGTATCCCTGTAAAGG + Intronic
1157660666 18:49439542-49439564 ATTTCTCTTTAGCAGTATGCTGG - Intronic
1159399716 18:67915219-67915241 ATTTCTCTGTTGGCCAGTGATGG - Intergenic
1159993788 18:74941715-74941737 ATTTTTCTGTAGCTCTATATTGG - Intronic
1164627151 19:29737332-29737354 AGTTCCCTGCAGCCCTCTGAGGG - Intergenic
1164765947 19:30769889-30769911 ATTTCTCTGTTGGCCAGTGATGG + Intergenic
1164945195 19:32287630-32287652 AGTTTACTGTAGCCATATGAAGG + Intergenic
1165682143 19:37786842-37786864 TTTTCTGTGTGACCCTATGATGG + Intronic
1165980131 19:39714678-39714700 ATTTCTCTGAAGGCCAGTGATGG + Intergenic
1166645935 19:44531733-44531755 ATCTCACTGCAGCCCTGTGAGGG + Intergenic
1167223248 19:48217634-48217656 ATTTCAATGAAGCTCTATGAAGG - Intronic
925180154 2:1812376-1812398 ACTGCTCTGTATCCCCATGATGG + Intronic
925846407 2:8038254-8038276 ATTTCTCTTTAGCTCCATCATGG + Intergenic
926980439 2:18561689-18561711 ATTTCTCTGTGGCTCTAACAGGG - Intronic
927420244 2:22923621-22923643 ATTTCACTGTATCCCTGTGGAGG + Intergenic
929375670 2:41283802-41283824 ATTTCTCCTTTGCCCTCTGAAGG - Intergenic
930322639 2:49875795-49875817 ATTTCTCTGATGGCCAATGATGG + Intergenic
933557017 2:83843422-83843444 ATTTCTGGGTAGGTCTATGAGGG + Intergenic
939043758 2:137224474-137224496 ATTTCACAGTAGTCCTATGTGGG - Intronic
939698427 2:145357838-145357860 GTTTCTCTCAAGCCCTAGGAAGG + Intergenic
942225225 2:173808941-173808963 ATTTCTGGGTATGCCTATGAGGG - Intergenic
942522672 2:176820533-176820555 ATTTCTGTGTAGCCTTAACAGGG + Intergenic
943244876 2:185433944-185433966 TTTTCTCTGCAGCCCTGTCAGGG + Intergenic
946150647 2:217765737-217765759 ATGTCTCTGTAACACTATGTAGG - Intergenic
947035452 2:225848840-225848862 ATCTCTCTGCAATCCTATGAAGG - Intergenic
1173224448 20:41154060-41154082 ATCTCACTGTAGTCCAATGAAGG + Intronic
1173934412 20:46848544-46848566 ATTTCTCCATGGCCCAATGAGGG - Intergenic
1173942831 20:46926621-46926643 ATTTCTAGGTATCCCTGTGAGGG - Intronic
1175045596 20:56101982-56102004 ATCTCTTTGTAGCCATGTGAAGG + Intergenic
1175702705 20:61151733-61151755 ATTGCTCTGTGGGCCTATGATGG + Intergenic
1180233767 21:46443999-46444021 ATTTCTCTGAGGCCCTATGTAGG - Intronic
1181430234 22:22876753-22876775 ATTTCTCTGTTGGCCAGTGATGG - Intronic
1181998148 22:26899302-26899324 ATTTCTCTGGAACCATATGGGGG + Intergenic
1184096196 22:42317776-42317798 TTTTCTCTGTAGCGTTGTGAGGG - Intronic
1184449024 22:44571862-44571884 ATTTCTCTCTAGGCTTATGGCGG - Intergenic
949322133 3:2823359-2823381 ATTTCTCTGCTACCCTAAGAAGG - Intronic
949666602 3:6346200-6346222 ATTTCTCTGATGGCCAATGATGG - Intergenic
950515135 3:13460214-13460236 ATTTCCCTGTGGCCCTGTGATGG - Intergenic
952115883 3:30180964-30180986 ATTTCTCCTTAACCCTGTGAGGG + Intergenic
952293519 3:32040935-32040957 TTATCTCTGTGTCCCTATGAAGG + Intronic
952649702 3:35710454-35710476 ATCTCTATGAAGCTCTATGAAGG - Intronic
953244873 3:41181864-41181886 TTCTCTCTGTACCTCTATGAGGG + Intergenic
953460660 3:43079269-43079291 ATTTACCTGTAGCCCAGTGAAGG - Exonic
953783291 3:45891145-45891167 ATTTCACTGCAGCCCTCTGGGGG - Intronic
955198177 3:56825145-56825167 TTTTCACAATAGCCCTATGAGGG - Intronic
957984669 3:87558505-87558527 ATTTCTCCTTTGCCCTTTGAAGG + Intergenic
963258111 3:143166545-143166567 ATTGCACTGTGGCCCTAGGATGG - Intergenic
963390467 3:144657353-144657375 ATTTCTCTCTTTCCCTATCAGGG + Intergenic
963428130 3:145158367-145158389 ACTTCTCTGTAGACCCATGAAGG + Intergenic
963697518 3:148580087-148580109 ATTTCTCTGATGGCCAATGATGG - Intergenic
965869505 3:173249345-173249367 GTTTTTCTGTAGCCCCATGGTGG - Intergenic
967310118 3:188097966-188097988 ATTTCTCTGGAGCCCCATTCTGG - Intergenic
968036299 3:195551042-195551064 ATTTCTCTGTCTCTCTATGGAGG - Intergenic
968787213 4:2631475-2631497 ATTTCTCTGTCTCCTTATAAAGG - Intronic
968963030 4:3754969-3754991 GTTTCTCTGCAGCCCTTAGAGGG - Intergenic
970047003 4:11865871-11865893 GTTTCTCTATATACCTATGAAGG + Intergenic
970197668 4:13568053-13568075 AATTCTCTGTAGCCATAAAAAGG - Intergenic
972491788 4:39594810-39594832 ATTTCTCTGATGCCCAGTGATGG - Intronic
975515699 4:75245463-75245485 ATTTCTCTGATGGCCTGTGATGG - Intergenic
976341311 4:83948068-83948090 ATTTCTCTGAAGCCCTGGGCCGG - Intergenic
977302388 4:95282433-95282455 AGTTCTCCTTAGCCCTCTGAAGG + Intronic
978350041 4:107811908-107811930 ATATCACTGTAGCCCTATAATGG + Intergenic
981122667 4:141070638-141070660 ATTTCTCTGATGCCCAGTGATGG - Intronic
981680829 4:147396027-147396049 ATTTCTCTGTGCATCTATGAGGG + Intergenic
983096963 4:163574047-163574069 ATTTCTCTGATGGCCAATGATGG + Intronic
986879117 5:12147956-12147978 CTTTCTCTGTCACCCTAGGAGGG + Intergenic
988202855 5:28090725-28090747 ATTTCTCTGTATGTGTATGATGG - Intergenic
988256009 5:28821023-28821045 ATGTCTCTTTAGCCCTGTAATGG + Intergenic
988629729 5:32916044-32916066 ATTTCTCTGTAGCCTTATTGAGG + Intergenic
989476377 5:41878647-41878669 ACTTCTCTGTAGGCGAATGAGGG + Intergenic
989864030 5:46424021-46424043 ATTTCTCTGTTGGCCAGTGATGG + Intergenic
990818359 5:59810251-59810273 AATTTTCTGTAACCCTGTGAAGG - Intronic
994237681 5:97383292-97383314 ATTTCTCTGATGGCCAATGATGG + Intergenic
994385724 5:99129461-99129483 ATTTCTCTGTAGGCCTCTATTGG + Intergenic
994417168 5:99486832-99486854 ATTTCTCTGTTGGCCAGTGATGG - Intergenic
994903499 5:105805500-105805522 TTTTCTCTGTAGCCTGAAGATGG - Intergenic
995627620 5:114096613-114096635 ATCTCACTGTAGCCCCAGGAAGG + Intergenic
995678467 5:114690361-114690383 AATTCTCTTTAGTTCTATGAAGG - Intergenic
997043898 5:130290563-130290585 ATTTCTTTGTATCCCGTTGATGG - Intergenic
997888170 5:137650331-137650353 TTTTTCCTGTACCCCTATGAGGG + Intronic
998649300 5:144099983-144100005 ATTTGTTTGTAGCCATAGGAAGG - Intergenic
1000422415 5:161053812-161053834 ATCTTTCTGTAGCCCTCTGTAGG - Intergenic
1005941346 6:30562551-30562573 ATTTCTCTGTAGCCCTATGATGG + Exonic
1007067955 6:39011854-39011876 ATTCCACTGTACCCCTATGAAGG + Intronic
1007135957 6:39522140-39522162 CCTTCTCTGGAGCCCTATCAAGG + Intronic
1007574542 6:42916411-42916433 ATTTCTCTATACCTCTAAGAGGG - Intronic
1007678337 6:43616611-43616633 ACTTCTCTCTAGCTCTGTGACGG + Intronic
1009062049 6:58408722-58408744 ATTTCTCTGATGGCCAATGATGG + Intergenic
1009776160 6:68208580-68208602 ATTTCTCTGATGCCCAGTGACGG - Intergenic
1010340672 6:74748577-74748599 AGTTCTCTGTATACCTATAATGG - Intergenic
1010754379 6:79650324-79650346 ATTACTCAGTAGCCCAAGGAGGG + Intronic
1010854878 6:80825394-80825416 ATTTCTCTGATGGCCTGTGATGG - Intergenic
1012513538 6:100032005-100032027 ATTTCTCTGATGCCCAGTGATGG - Intergenic
1012915766 6:105168743-105168765 ATCTCTCTCCAGTCCTATGATGG - Intronic
1013437901 6:110131387-110131409 ATTTCTCTATTGCTCTATGGTGG + Intronic
1014766371 6:125411158-125411180 ATTTGTCTGTAGTCCGAGGAAGG + Intergenic
1015068383 6:129058701-129058723 ACTTCTCTTTTGCCCTCTGAAGG + Intronic
1016742403 6:147542074-147542096 ATCTGTCTGTAGCCCCATGGTGG - Intronic
1018189115 6:161292850-161292872 GTCTGTCTGTAGCCCTATTATGG + Intergenic
1018397389 6:163388818-163388840 AGTTCTTTGTGGCCCTATCATGG - Intergenic
1018523855 6:164685329-164685351 ATTTCTTTGTAGCACAAGGAAGG - Intergenic
1021253007 7:18355247-18355269 ATTTCTGTGTAACCCTGAGAAGG - Intronic
1023073207 7:36458263-36458285 AGTTCTCTTTGGCCCTCTGAAGG - Intergenic
1024577227 7:50774530-50774552 AGTTCTCTCCAGCCCTTTGATGG + Intronic
1026585138 7:71649837-71649859 AATTCTCGTTAACCCTATGAGGG + Intronic
1026601807 7:71783618-71783640 GTTTCCCTGAGGCCCTATGAGGG - Exonic
1027517190 7:79156845-79156867 ACTTCTCTGAGGCCCTATGTTGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028180704 7:87719897-87719919 ATTTCTATATAACCCTATGTAGG + Intronic
1030739436 7:113090771-113090793 ATTTCTCTGATGGCCAATGATGG - Intergenic
1031175230 7:118340470-118340492 ATTTCTCTGATGATCTATGATGG + Intergenic
1032657674 7:133949252-133949274 CTATCTCTGTACCCATATGAAGG - Intronic
1034081759 7:148284972-148284994 ACTTTTCTGTAGCACTTTGAAGG + Intronic
1035383763 7:158457097-158457119 ATTGCTGTGTAGACGTATGATGG - Intronic
1036223682 8:6941169-6941191 GTTTCTCTGCAGCCCAAAGAGGG - Intergenic
1037629923 8:20646341-20646363 ATTTCTCAAAAGCTCTATGAAGG + Intergenic
1038706266 8:29896864-29896886 ATTTCTGTCTGGTCCTATGATGG - Intergenic
1039766565 8:40634406-40634428 ATTTCTCTCTAGCTCTTTTATGG - Intronic
1039790868 8:40874638-40874660 GTTTCTCTGTAGCCCTCTCAGGG + Intronic
1040090303 8:43391810-43391832 ATTTCTCTGAAGGCCAGTGATGG + Intergenic
1040092554 8:43413073-43413095 ATTTCTCTGAAGGCCAGTGATGG + Intergenic
1041897621 8:62944177-62944199 ATTTCCCTGTTGTCCTATGATGG + Intronic
1043706592 8:83358302-83358324 GTTTGTCTGTAGCCCCATGGAGG - Intergenic
1043706630 8:83358534-83358556 GTCTTTCTGTAGCCCCATGATGG - Intergenic
1044396460 8:91718893-91718915 ATTTCTCTACAGCACTATGGGGG - Intergenic
1044884347 8:96760621-96760643 AGTACTCTGGAGCCCTATAAAGG + Intronic
1045467330 8:102482351-102482373 ATTTCTCAGTATGTCTATGAGGG + Intergenic
1045654688 8:104374804-104374826 TTGTCTCTGCAGCCCTATGAGGG - Intronic
1047580146 8:126205001-126205023 ATTTCTCTGATGGCCAATGATGG - Intergenic
1049676874 8:143893428-143893450 ACTTCTCTGTGGCCTGATGAAGG - Intergenic
1051706705 9:19888576-19888598 ATTTATTTGTAGGCCTAAGAGGG + Intergenic
1055425932 9:76196647-76196669 ATTTCTCTCCATCCCTATAATGG - Intronic
1055981405 9:82006107-82006129 ATTTTTCTCTTGCCCTGTGAAGG - Intergenic
1056131301 9:83589372-83589394 ATTTCTCTGATGGCCTGTGATGG + Intergenic
1058354577 9:104068812-104068834 CTCTCTCTGTTGCCCTATCAGGG + Intergenic
1059118720 9:111622189-111622211 ATTTTTCTGTGGCTCTCTGATGG + Intergenic
1188021369 X:25162423-25162445 GTTTTTCTGTAGCCTTATAAGGG + Intergenic
1190478383 X:50850432-50850454 CTGGCTCTGTAGCCCTATGGTGG - Intergenic
1191119581 X:56889483-56889505 ATTTCTCTGTTGGCCAGTGATGG + Intergenic
1193038935 X:76984008-76984030 ATTTCTCTGATGGCCCATGATGG - Intergenic
1193583361 X:83291668-83291690 ATTTCTCTGATGGCCAATGATGG - Intergenic
1193909868 X:87290705-87290727 ATTTCTCTGAAGACCAGTGATGG + Intergenic
1195198339 X:102520727-102520749 ATTTCTTTGTTCCCCTTTGATGG + Intergenic
1195704694 X:107730388-107730410 ATTCCTCTGCAGCTGTATGAAGG - Intronic
1195855736 X:109330548-109330570 ATTTCTCTGTTGGCCAGTGATGG + Intergenic
1196306728 X:114111769-114111791 AGTTCTCCTTTGCCCTATGAGGG + Intergenic
1197849390 X:130841494-130841516 ATTCCTCTCTAGCCCTGTAAAGG - Intronic
1198676985 X:139141531-139141553 ATTTCTCTGTTTCTCTATCATGG + Intronic
1199664789 X:150088134-150088156 CTGTCTCTGTAGCCCCATAAAGG - Intergenic
1200341544 X:155402390-155402412 ATTTCTCTGATGGCCAATGATGG - Intergenic
1200867091 Y:8056228-8056250 ATTTCTCTGATGCCCAGTGATGG + Intergenic
1200889344 Y:8306431-8306453 ATTTCTCTGATGGCCAATGATGG + Intergenic
1201939427 Y:19443899-19443921 GTTTTTCTGTAGCCCCATGGTGG + Intergenic