ID: 1005942507

View in Genome Browser
Species Human (GRCh38)
Location 6:30571382-30571404
Sequence CGGGGTTGGCCGCGCCAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005942496_1005942507 17 Left 1005942496 6:30571342-30571364 CCGAGATGACGGCGAAGCTCGCA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005942507 6:30571382-30571404 CGGGGTTGGCCGCGCCAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1005942492_1005942507 25 Left 1005942492 6:30571334-30571356 CCACGCCCCCGAGATGACGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 1005942507 6:30571382-30571404 CGGGGTTGGCCGCGCCAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1005942494_1005942507 19 Left 1005942494 6:30571340-30571362 CCCCGAGATGACGGCGAAGCTCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1005942507 6:30571382-30571404 CGGGGTTGGCCGCGCCAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1005942493_1005942507 20 Left 1005942493 6:30571339-30571361 CCCCCGAGATGACGGCGAAGCTC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1005942507 6:30571382-30571404 CGGGGTTGGCCGCGCCAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1005942495_1005942507 18 Left 1005942495 6:30571341-30571363 CCCGAGATGACGGCGAAGCTCGC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1005942507 6:30571382-30571404 CGGGGTTGGCCGCGCCAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005942507 Original CRISPR CGGGGTTGGCCGCGCCAGCT TGG Exonic