ID: 1005944476

View in Genome Browser
Species Human (GRCh38)
Location 6:30585422-30585444
Sequence ACTCACAGGCACAGTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005944476 Original CRISPR ACTCACAGGCACAGTGGAGA AGG (reversed) Intronic
900777591 1:4596244-4596266 ACTCCCAGGCTCAGAGGACATGG + Intergenic
901101628 1:6723557-6723579 AGACACAGACACAGGGGAGACGG + Intergenic
901260304 1:7866057-7866079 AGCCACAGGCACCGTGGAAAGGG + Intergenic
901689146 1:10961203-10961225 AATCACAGGCTCAGTGCAAAGGG + Intronic
902314779 1:15610130-15610152 ATTCACACACACAGTGGAGTGGG + Intergenic
902393177 1:16118129-16118151 ACACACAAGCTCAGAGGAGAGGG + Intergenic
903780046 1:25815237-25815259 GGTCACAGGAACAGAGGAGAGGG + Intronic
904348608 1:29890468-29890490 ACCCACAGGGACTGTGGAAATGG + Intergenic
904865535 1:33575836-33575858 AAGCACAGGCACAGGCGAGAAGG + Intronic
906748587 1:48239131-48239153 ACTTAAAGGCACAGTGGAATAGG - Intronic
908366225 1:63426335-63426357 AAAAACAGGCACAGTTGAGAGGG + Intronic
909562448 1:77021755-77021777 AATCACAGGCTTATTGGAGAGGG - Intronic
909710716 1:78646526-78646548 ACTCACAATCATAGTGGAAAGGG + Intergenic
910655009 1:89610219-89610241 ACTGACAAGCACAGTGGGGAGGG - Intergenic
913189855 1:116404408-116404430 ACCCACAGGCTGGGTGGAGAAGG + Exonic
914965489 1:152253733-152253755 ACTCACAATCACAGTGGAAGGGG - Intergenic
916046195 1:161001415-161001437 AGTCACAGACCCAGTGGACAGGG + Intronic
916865211 1:168849127-168849149 ACTCAGAGTTACAGTGCAGAGGG - Intergenic
918466438 1:184826113-184826135 ACCCACAGGCACAGTGGGACTGG - Intronic
918552651 1:185761197-185761219 ACTCAAAGGCAAAAAGGAGATGG + Intronic
918663119 1:187114211-187114233 ACTCATAGGCACAGAGTAGGAGG + Intergenic
920192286 1:204201388-204201410 GCTCACAGGCACAGTGCTGGGGG + Intronic
920307154 1:205026397-205026419 ATTAACAGGCCCAGTGGGGAGGG + Intergenic
920704586 1:208242374-208242396 ATTCACGCGCACAGTGGACAAGG - Intronic
920963185 1:210681859-210681881 TCTTCCAGGCACAGTGGAGCTGG - Exonic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
922064760 1:222125988-222126010 AGGCACAGACACAGTGGAGGAGG - Intergenic
922134766 1:222814292-222814314 AAGGACAGGCACAGTGGAGAAGG - Intergenic
922872731 1:228916341-228916363 AGGCACAACCACAGTGGAGATGG + Intergenic
923543736 1:234908860-234908882 CGTAACAGCCACAGTGGAGAAGG - Intergenic
924099634 1:240590057-240590079 ACTCCCAGGCACTGAGGAAAGGG - Intronic
924652869 1:245946643-245946665 ACGTACAGGCAGAGTGGGGAGGG + Intronic
1062805779 10:418314-418336 CCCGACAGGCACAGTGGACAGGG - Intronic
1062920091 10:1273019-1273041 AGACACAGACACAGAGGAGAAGG - Intronic
1063567293 10:7181968-7181990 CTTCCCAGGCACAGTGGACAGGG + Intronic
1063956826 10:11275022-11275044 ACACAAGGGCAAAGTGGAGACGG - Intronic
1063980753 10:11449798-11449820 ACTCACTGGCACATGGTAGATGG + Intergenic
1064642362 10:17427567-17427589 CCTCACAGTTACAGAGGAGAAGG + Intronic
1069721629 10:70553576-70553598 ACACACAGGCAAAGTGAGGACGG - Intronic
1069955634 10:72049596-72049618 ATAGACAGGCACAGAGGAGAAGG + Intergenic
1070406935 10:76105543-76105565 ACACAGAGACACAGGGGAGAAGG + Intronic
1070630435 10:78080936-78080958 CCCCACAGGCAGAGAGGAGAAGG + Intergenic
1071567809 10:86680678-86680700 AATGGCAGGCACAGGGGAGAAGG + Intronic
1071842037 10:89482635-89482657 ATTCCCAGGCACAGTGGCGTGGG + Intronic
1074248882 10:111723862-111723884 TCTCACTTCCACAGTGGAGAAGG + Intergenic
1075306779 10:121374942-121374964 CCACACAGACACAGGGGAGAAGG + Intergenic
1075550541 10:123389533-123389555 ATACACAGACACAGAGGAGAAGG - Intergenic
1075629715 10:123993809-123993831 ACTCAAAGGCAAAGTGGACAGGG + Intergenic
1076107707 10:127836450-127836472 ACTCACATGCAGAATGGAAATGG + Intergenic
1076598594 10:131642075-131642097 ACTCACAGTCTCACTGGACAAGG + Intergenic
1076995599 11:296160-296182 GCTCATGGCCACAGTGGAGAGGG + Intergenic
1077028964 11:455019-455041 ACACACAGGCCCACTGGAGGAGG - Intronic
1078222336 11:9362369-9362391 ACTTACAGGCAGAGAGGACAGGG - Intergenic
1078976549 11:16484527-16484549 ACACATGGGCACAGTCGAGATGG + Intronic
1081930698 11:46868807-46868829 ACTCCCAGGGACAGGGGAGGAGG + Intronic
1083325133 11:61869318-61869340 GGTCACAGGCACAGGGCAGAGGG - Intergenic
1084931908 11:72562487-72562509 ACAGGCAGGCACAGTTGAGATGG - Intergenic
1085526133 11:77165352-77165374 ACTCACAGGGACCGAGGAGTTGG - Intronic
1088135100 11:106546337-106546359 ACACACATGCACAGTTCAGATGG + Intergenic
1089047428 11:115515140-115515162 ACACACAGACACAGAAGAGATGG + Intergenic
1089069904 11:115691533-115691555 ACTCAGAAGCACAGAGTAGAAGG + Intergenic
1089197361 11:116702062-116702084 GCCCACAGGGACAGTGGAGGAGG - Intergenic
1091317889 11:134628269-134628291 AGGCAGGGGCACAGTGGAGAAGG - Intergenic
1094172603 12:27509419-27509441 GCTCACAGGTGCAGTGGAGGGGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096225619 12:49865172-49865194 ACACAGAGACACAGAGGAGAAGG + Intergenic
1096244270 12:49975566-49975588 CCTCACAGGCACCGTAGAGGTGG + Exonic
1097763434 12:63495050-63495072 ACACACATACACAGAGGAGAAGG - Intergenic
1098108380 12:67095025-67095047 AATCACAGCCACAGTGGACTCGG + Intergenic
1098283255 12:68883026-68883048 ACACACACGCACAGTGGGGGTGG + Intronic
1098387329 12:69933340-69933362 ACTCAAAGGCCCAGAGAAGACGG - Intronic
1098618210 12:72556585-72556607 GCTGCCAGGCAAAGTGGAGAGGG + Intronic
1101238641 12:102815576-102815598 ACTCTAGGTCACAGTGGAGAAGG - Intergenic
1101275027 12:103189987-103190009 ACACACACACACAGAGGAGAGGG + Intergenic
1102215747 12:111160447-111160469 ACACACAGGCACAGAGATGAAGG - Intronic
1102731519 12:115115264-115115286 TCTCACAGGCACTGGAGAGATGG + Intergenic
1103469840 12:121171327-121171349 ACATAGAGACACAGTGGAGAAGG - Intronic
1103571758 12:121849596-121849618 ACACACATGCGCAGTGGACATGG + Intronic
1104314128 12:127681222-127681244 ACCCAAAGGCATTGTGGAGATGG - Intergenic
1104521786 12:129482193-129482215 ACGCATAAGCACAGTGGAGATGG - Intronic
1104804921 12:131581618-131581640 ACAGACAGGCAGAGTGCAGAGGG - Intergenic
1104959486 12:132481600-132481622 ACACACAGGCCTAGGGGAGACGG - Intergenic
1106231740 13:27826034-27826056 ACTCACAGGAAGAGTGAAGGAGG + Intergenic
1106343065 13:28849810-28849832 ACTCAGAGGTAGAGAGGAGAGGG - Intronic
1106689074 13:32094543-32094565 ACTCATAGACACAGAGTAGAAGG - Intronic
1106845783 13:33736456-33736478 ACTCCCTGGCCTAGTGGAGAGGG - Intergenic
1107058299 13:36130333-36130355 ACTCACAGGTGCAGCAGAGAGGG + Intronic
1108523025 13:51261813-51261835 ACTCACAGGCACAGAGTGGTTGG - Intronic
1108836060 13:54550366-54550388 ACTCACATGACCAGTGAAGAGGG - Intergenic
1110142151 13:72143728-72143750 ACACCCAGACACAGAGGAGAAGG + Intergenic
1112998209 13:105599910-105599932 TCTCAAAGCCACAGTTGAGAAGG - Intergenic
1113544678 13:111139132-111139154 GCTCAAAGGTACAGTAGAGATGG + Intronic
1114537980 14:23435058-23435080 ACTCACAGGCACGGGGGTGTAGG - Intronic
1114678231 14:24459958-24459980 GGCCACAGCCACAGTGGAGATGG - Intergenic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1115722294 14:36176401-36176423 ACTCACAGGCAGAGTAGAAATGG + Intergenic
1118845087 14:69541958-69541980 ACTTCCAGGCACAATGGAAAGGG - Intergenic
1119672661 14:76531227-76531249 AGACACAGGCGCAGAGGAGAAGG - Intergenic
1119884704 14:78130428-78130450 ACTTACAGGCACAGTGCAACTGG - Intergenic
1120039668 14:79738343-79738365 ACACACACACACAGAGGAGAAGG + Intronic
1120574653 14:86167563-86167585 ACACACAAGAACAGAGGAGAAGG + Intergenic
1121078774 14:91090774-91090796 TTTGACAGGGACAGTGGAGATGG - Intronic
1122103837 14:99435993-99436015 ACTCACAATCACAGAGGAGGAGG + Intronic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122630321 14:103104629-103104651 ACTGACAGGCACAGCGGGGCGGG + Intronic
1123695686 15:22877675-22877697 CCTCACACTCACAGTGGTGAGGG + Intronic
1124047044 15:26160096-26160118 ACTCTCAGGCACCGAGGAAAGGG + Intergenic
1124782058 15:32645440-32645462 ATTCACAGTCTGAGTGGAGAGGG + Intronic
1125987096 15:44064218-44064240 ACTGACAGACACAGTGGTGGTGG - Intronic
1128790706 15:70431783-70431805 GCTGTCAGTCACAGTGGAGAGGG - Intergenic
1130241923 15:82201826-82201848 GCTTACAGACAAAGTGGAGAAGG - Intronic
1130300297 15:82675461-82675483 ACTCCCACGCACAGTGGACATGG + Intronic
1130369828 15:83275713-83275735 GCTCTCAGGCACAATAGAGATGG + Intronic
1130458455 15:84139028-84139050 GCTTACAGACAAAGTGGAGAAGG + Intergenic
1131392237 15:92058891-92058913 AGACACAGGCACAGAGGGGAAGG - Intronic
1131737264 15:95347007-95347029 AAACACAGGCACAGAGGGGATGG + Intergenic
1133215912 16:4292452-4292474 ACCCAGAGGGACACTGGAGATGG - Intergenic
1135559727 16:23466915-23466937 ATTCTAAGGCACAGTGGTGAAGG + Exonic
1137731213 16:50691891-50691913 ACTCACTGGCATGGTGAAGATGG - Intergenic
1137913567 16:52403963-52403985 ACCCACAGACACCGTGGAGAAGG + Intergenic
1138231867 16:55343725-55343747 ACTCCCAGCAACTGTGGAGAGGG - Intergenic
1140354877 16:74297034-74297056 AGTCACGGGCACGCTGGAGATGG + Intronic
1140944787 16:79757858-79757880 GTTCACAGGCACAGTGCAAATGG - Intergenic
1141818655 16:86430321-86430343 ACAAAGAGGCCCAGTGGAGAGGG + Intergenic
1143675155 17:8427037-8427059 ATTCTCAGGCACAGTGGAAAGGG + Intronic
1144460977 17:15458395-15458417 TCTCACAGTCAGAGTGGAGGGGG + Intronic
1145259265 17:21345083-21345105 ACCCACAGGACCAATGGAGAGGG - Intergenic
1145317351 17:21742865-21742887 ACCCACAGGTCCAATGGAGAGGG + Intergenic
1146559421 17:33855268-33855290 ACTCACAGACCCAGTTGAGGGGG - Intronic
1147545685 17:41399585-41399607 AGCCAAAGCCACAGTGGAGATGG - Intergenic
1147706658 17:42429976-42429998 ACTCTCAGGAAGAGTGGGGAAGG + Intergenic
1150067614 17:62124786-62124808 ACACAGAGGAACTGTGGAGAAGG - Intergenic
1150604349 17:66678176-66678198 AATTACAGGCACAGAGAAGAAGG + Intronic
1150665991 17:67138862-67138884 AATGTCTGGCACAGTGGAGAAGG + Intronic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1152089047 17:78237040-78237062 GCTCCCAGGCACAATGCAGAGGG - Intronic
1152636389 17:81432270-81432292 ACACACAGGCACACAGGAGACGG - Intronic
1153034396 18:746301-746323 AGTCACAGGAACAGTAGAGAGGG + Intronic
1153102942 18:1495101-1495123 ACCCACAGGCTCAAAGGAGAGGG - Intergenic
1153797076 18:8633699-8633721 ATCCGCAGGCACCGTGGAGAAGG - Intronic
1155711860 18:28890996-28891018 ACACACAGGGACAGTGCTGAAGG + Intergenic
1156931149 18:42645154-42645176 ACTCAAAGGCAGATAGGAGAGGG - Intergenic
1156953847 18:42937447-42937469 CCTCAGAGGTACAGCGGAGAAGG + Intronic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157808054 18:50672928-50672950 ACCCACAGGCACATTGGAAAGGG - Intronic
1158490018 18:57901605-57901627 ACACACACACACAGAGGAGAGGG + Intergenic
1160534062 18:79581914-79581936 GCTCACATGCACAGTGCACACGG + Intergenic
1160690521 19:459013-459035 ACTCAGATGCACAGAGGAGCGGG - Intronic
1161192301 19:2964868-2964890 ACTCACAGGCTAAGTGCAGTAGG - Intergenic
1161738377 19:6005599-6005621 AGTGACAGGCACAGTGAGGAAGG - Intronic
1162568241 19:11456025-11456047 ACACAAAGGCAGAGTGGAAAGGG - Intronic
1163753396 19:19092119-19092141 AGACACAGACACAGTGGGGAGGG - Intronic
1165091109 19:33388840-33388862 ACTCACAGGCACAGCTGAGGGGG + Intronic
1165257706 19:34589634-34589656 CCACACAGGCTCAGTGGAGAAGG + Intergenic
1165913520 19:39244240-39244262 GGTGACAGGCACAGGGGAGAGGG + Intronic
1165917440 19:39269384-39269406 GGTGACAGGCACAGGGGAGAGGG - Intronic
925465451 2:4104262-4104284 CCTCACAGGCACAGGGGACCAGG + Intergenic
925926412 2:8674111-8674133 ACTCAAAAGCACAGTGGAGAGGG + Intergenic
926394480 2:12427197-12427219 ACTCACAAGCTCAGTCTAGAAGG + Intergenic
926961414 2:18362309-18362331 CCTCCCCGGCAGAGTGGAGATGG + Intergenic
927177366 2:20420056-20420078 GCTCACAGGAACAGGGAAGATGG + Intergenic
929829353 2:45334667-45334689 ACTCACAGGCTCAGTGACGTGGG + Intergenic
929873159 2:45774803-45774825 ACTCCCAGGCACACGGGAAAGGG - Intronic
931584709 2:63812654-63812676 AGTCACAGGCACAGTTTAGCTGG - Intronic
931597997 2:63971198-63971220 AGTAACAGTTACAGTGGAGATGG - Intronic
931844178 2:66185606-66185628 ACTCTCAGGCAGGGTGGAGCTGG + Intergenic
932169085 2:69537438-69537460 ACCCACAGGCAGAGTGGCGCTGG + Intronic
932252823 2:70259032-70259054 ACTCACGGGCACATTAGAGGTGG - Intronic
935092092 2:99905037-99905059 AGTGACAGCCACAGAGGAGAAGG - Intronic
936373815 2:111924293-111924315 GCTCACAGGGAAAGTGGGGATGG - Intronic
937064720 2:119009246-119009268 ACTCCCAGCCACAGTGGAAGAGG + Intergenic
937319615 2:120953255-120953277 ACACAGAGTCACAGAGGAGAAGG + Intronic
938013478 2:127847921-127847943 ACTCACAGGCCCAGGTGACATGG - Exonic
939009960 2:136834295-136834317 ACTCACAGCCACAGTGGCTATGG + Intronic
940342810 2:152599115-152599137 ACGCCCAGCCACATTGGAGAGGG + Intronic
941722155 2:168823693-168823715 ATTCACAGGCACTGGGGAGTAGG + Intronic
942078808 2:172381525-172381547 ACTCACAGGCAAGATGCAGATGG - Intergenic
942176426 2:173339066-173339088 AGACACAGACACAGAGGAGAAGG + Intergenic
942511331 2:176705480-176705502 ACTCACTGGCACACCTGAGATGG + Intergenic
942885368 2:180916864-180916886 CCTCACAGTCATGGTGGAGAAGG - Intergenic
943119436 2:183716206-183716228 ACTAACTAGCACAGAGGAGAAGG - Intergenic
944953727 2:204783722-204783744 ACTCAAAGGCACAGTAGTAAGGG + Intronic
945027069 2:205629682-205629704 ACTCAAAGGCACAGCCCAGAGGG - Intergenic
947851645 2:233293316-233293338 GCTCACAGGGAAAGTGGAAAAGG + Exonic
948459965 2:238124288-238124310 TCTGACAGGCACAGTGGGGGAGG + Intronic
1169226963 20:3862967-3862989 ACTGACAGGCACAGTGCAGTGGG + Intronic
1170842129 20:19932572-19932594 AGTCACAGGCACCGAGGGGATGG + Intronic
1171330896 20:24338009-24338031 ACTAACAGATACAGTGGAGCAGG - Intergenic
1172886797 20:38236726-38236748 TCTCAGTGGCACAGTGGGGAAGG + Intronic
1172929940 20:38579397-38579419 GCTCCCAGGCACAGTTCAGAGGG - Intergenic
1173874645 20:46362703-46362725 ACTCATTGGAGCAGTGGAGATGG - Intronic
1174046702 20:47738963-47738985 ACGCACAGGCACAGAGGGGAAGG + Intronic
1174366484 20:50059695-50059717 ACAGAGAGGCACAGAGGAGAAGG + Intergenic
1174864612 20:54123662-54123684 CCTCACGGGCACTCTGGAGAGGG + Intergenic
1175066463 20:56293050-56293072 ACACACACACACATTGGAGATGG - Intergenic
1175733576 20:61370455-61370477 ACTCAGCGGCACTGGGGAGAGGG - Intronic
1176043390 20:63080003-63080025 ACACACAGCCACAGAGGACAAGG + Intergenic
1176069432 20:63218368-63218390 AGACACAGGCACAGAGGAAAAGG - Intergenic
1178792242 21:35711333-35711355 ACTCACAGAAACAGTGGGGAGGG + Intronic
1179285488 21:39974405-39974427 AGACACAGGCATAGAGGAGAAGG - Intergenic
1179285515 21:39974582-39974604 AGACACAGGCATAGAGGAGAAGG - Intergenic
1179285528 21:39974656-39974678 AGACACAGGCATAGAGGAGAAGG - Intergenic
1179285567 21:39974878-39974900 AGACACAGGCATAGAGGAGAAGG - Intergenic
1179285593 21:39975026-39975048 AGACACAGGCATAGAGGAGAAGG - Intergenic
1179974820 21:44858626-44858648 AGTCACAGTCACAGTGGGGAGGG - Intronic
1181423495 22:22818039-22818061 AAGCCCAGGGACAGTGGAGATGG - Intronic
1181970267 22:26684509-26684531 AGTCACAGGCACAGGGTAGCTGG - Intergenic
1182661635 22:31929284-31929306 ACACACAGGCTCAAGGGAGATGG + Intergenic
1183198632 22:36370698-36370720 GCTCACAGGCACTGGGCAGAAGG + Intronic
1183605250 22:38864051-38864073 CATCGCAGGCACTGTGGAGAGGG - Exonic
1184491930 22:44814855-44814877 ATACACAGGCACCCTGGAGACGG - Intronic
1184885319 22:47341574-47341596 AGTCACAGGCCCAGTGGACAAGG + Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952174284 3:30844471-30844493 ATTCAAAGGGACAGTGGGGAAGG + Intronic
953119763 3:40028117-40028139 ACACACAGGCTCAATGGAGTTGG - Intronic
953580934 3:44155955-44155977 ACTCATAGACGCTGTGGAGAGGG - Intergenic
954217556 3:49132940-49132962 ACCCACAGGCAGAGTTGACACGG - Exonic
954660017 3:52222014-52222036 CCCCACAGGCGCAGTGCAGAGGG + Exonic
954929206 3:54266193-54266215 AGTTTCATGCACAGTGGAGATGG - Intronic
955492381 3:59496133-59496155 ACACAGAGGCACAGGGGAGATGG + Intergenic
955934690 3:64091405-64091427 ATACATAGGCACAGTGGGGAGGG + Intergenic
956856551 3:73280795-73280817 AAAGACAGGCACAGTGGTGACGG - Intergenic
959054688 3:101555569-101555591 ACTCTCAGGCAGATAGGAGAGGG + Intergenic
959682358 3:109109833-109109855 ACTCACCCGCCCAGTGGAGTTGG - Intronic
959996890 3:112690149-112690171 AGACACAGGCCCAGTGGAGCAGG + Intergenic
960794842 3:121474413-121474435 ACTCACAAGCTCAGATGAGAGGG + Intronic
960913667 3:122675661-122675683 ACTTACAGAGATAGTGGAGATGG + Intergenic
961081885 3:124034179-124034201 GCTGACAGGCACAGGGGAGGGGG - Intergenic
961190131 3:124953456-124953478 CCTCACAGGCATGGTGGGGAGGG - Intronic
962022911 3:131518689-131518711 GGTCACAGGCACAGTGGAAAGGG - Intergenic
963224371 3:142846728-142846750 ACTCACAGGTAGATGGGAGATGG - Intronic
964639451 3:158893165-158893187 ACTCCCAAGCACAGTAGTGAAGG - Intergenic
968075312 3:195812903-195812925 ACTCACAGGCACAAGCGAGGAGG + Intergenic
969061339 4:4437734-4437756 TCTCAAAGGCAGAGTGGAGCAGG - Intronic
969089150 4:4680239-4680261 ACTCACTGCCACAGTGGAAAGGG - Intergenic
969388101 4:6870036-6870058 TCTCTCAGGCACAGTGAGGAAGG + Intronic
969433135 4:7167636-7167658 ACTCAGAGGGGCAATGGAGACGG - Intergenic
971910632 4:32792391-32792413 ACTCAAAGTCACAGGGGAGTAGG - Intergenic
975469365 4:74747447-74747469 ATTCAGAGGCACATTGGAGGAGG - Intronic
978394340 4:108262569-108262591 ACTCACAGCCACAGAAGAAATGG + Intergenic
979857068 4:125646990-125647012 ACTAACAGACACAGGGAAGAAGG - Intergenic
980154714 4:129090666-129090688 ACTCACTGGCAGAGTGGTGATGG - Intronic
980661167 4:135860408-135860430 ACTCACAGGCAGACAGGTGAGGG - Intergenic
981472088 4:145147968-145147990 ACTCACACACACAATGGAGAAGG + Intronic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
984734067 4:183094544-183094566 ACTCACTAGCATAGTGAAGACGG + Intergenic
985574575 5:668060-668082 ACCGACAAGCACACTGGAGAGGG + Intronic
986290173 5:6393422-6393444 ACTCACAGGCTCTGAAGAGAAGG + Intergenic
986349670 5:6866103-6866125 ACACAGAGACACAGGGGAGAAGG + Intergenic
986719011 5:10546592-10546614 ACCCAGACACACAGTGGAGAAGG - Intergenic
986762109 5:10889656-10889678 AGTTACAGGCCCAGTGGAGCTGG + Intergenic
989350985 5:40486465-40486487 AATCACAGGCACTGTGGACTGGG - Intergenic
990071170 5:51784792-51784814 AATCACAGGTACTGAGGAGATGG + Intergenic
991494307 5:67212516-67212538 ACACACACACACAGAGGAGAAGG - Intergenic
993718261 5:91296583-91296605 ATTTCCAGGTACAGTGGAGACGG + Intergenic
993766426 5:91864146-91864168 ACCCACAGACACAGGAGAGAAGG - Intergenic
993979382 5:94526323-94526345 ACCCTCTGGCACAGTGGGGATGG + Intronic
995147997 5:108808462-108808484 ACCCACAGGCACAGAGTAAAGGG - Intronic
996541934 5:124639265-124639287 AGATACAGGCCCAGTGGAGAAGG + Intronic
997212797 5:132087370-132087392 ACTGACAGACATAGAGGAGATGG + Intergenic
999310016 5:150545871-150545893 ACTGCCATTCACAGTGGAGAAGG + Intronic
1000180547 5:158806220-158806242 ACTACCAGGCACGGTGGAGAGGG + Intronic
1001648720 5:173300607-173300629 GCTCTCAGGCACAGTGTAGGAGG + Intergenic
1003475252 6:6475724-6475746 ACACACAGAGACAGAGGAGAAGG - Intergenic
1003532649 6:6950798-6950820 ACTCACAGACGCAGAGTAGAAGG - Intergenic
1003566881 6:7229746-7229768 CCTCAAAGGCTCAGTGGAGGCGG + Exonic
1004934134 6:20491161-20491183 ACTCACAAACACATTGGGGACGG - Exonic
1005234154 6:23740553-23740575 ACACAGAGACACAATGGAGAAGG + Intergenic
1005758652 6:28948076-28948098 ACTCACAGGCTCAGAGGTTATGG - Intergenic
1005944476 6:30585422-30585444 ACTCACAGGCACAGTGGAGAAGG - Intronic
1006843758 6:37048835-37048857 ACTCACAGCTGCAGTGGGGAGGG - Intergenic
1007260111 6:40557453-40557475 ACCTACAGGCACAGTGGTCAGGG + Intronic
1007515867 6:42411004-42411026 GCTCACAGGGACTGTGGGGAAGG + Intronic
1007707794 6:43801612-43801634 ATTGACAGGCACAGGGCAGATGG + Intergenic
1008242195 6:49127388-49127410 CATCACAGGCCCAGAGGAGAAGG + Intergenic
1008947790 6:57118249-57118271 ACATACAGGCAAAGTGGACAAGG - Intronic
1009373431 6:62937998-62938020 AAGCACAGTCACAGTGGTGATGG - Intergenic
1009578094 6:65493267-65493289 AGCCTCAGGCACAGGGGAGAAGG + Intronic
1009873370 6:69475270-69475292 AGACACAGACACAGTGGAGTGGG - Intergenic
1010373260 6:75136399-75136421 ACTCAAAGTCACACTAGAGATGG + Intronic
1011314652 6:86017877-86017899 ACTCACAGGCTCACAGGACAGGG - Intergenic
1011389443 6:86835908-86835930 TCTCACAAGCACTTTGGAGAAGG - Intergenic
1013782068 6:113739696-113739718 ACTGATAGTCACAGAGGAGAAGG - Intergenic
1014108390 6:117592583-117592605 ACACACAGACACAGAGAAGAAGG - Intronic
1014737662 6:125113000-125113022 ATTCATGGGCACAGTGGAGCTGG + Intergenic
1014797534 6:125743854-125743876 GCTCAACTGCACAGTGGAGAAGG - Intergenic
1014871871 6:126605918-126605940 GCTGACAGGCCCAGTGAAGAAGG - Intergenic
1015139037 6:129909190-129909212 ACTCACTGGCAGACTGGATATGG - Intergenic
1016271762 6:142298241-142298263 ACTCACATGCACACAGGAAAGGG + Intergenic
1016518222 6:144921015-144921037 ACTCAGAGGGAAAATGGAGAAGG + Intergenic
1017331963 6:153209654-153209676 ACACACAGGCATTGTGAAGATGG - Intergenic
1017468601 6:154717853-154717875 ACAGACAGACACAGAGGAGAAGG + Intergenic
1018743558 6:166747935-166747957 AGACACAGGCACTGTGCAGAGGG + Intronic
1018797954 6:167201884-167201906 ACACAGAGACACAGAGGAGAAGG + Intergenic
1018814761 6:167322288-167322310 ACACAGAGACACAGAGGAGAAGG - Intergenic
1018830475 6:167438695-167438717 ACACAGATGCACAGAGGAGAGGG - Intergenic
1019023626 6:168940132-168940154 ACCCACACGCACAGTGGAATCGG + Intergenic
1020410197 7:7883652-7883674 ACTCTGAGGCACATTGGAGAAGG + Intronic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1024550338 7:50557651-50557673 GCTAACAGGCAAAGTGGGGATGG - Intronic
1027343227 7:77232218-77232240 ACACACAGACCCAGTGGAAAAGG - Intronic
1030410518 7:109172967-109172989 ACACAGAGGCATAGGGGAGAAGG - Intergenic
1032685244 7:134226209-134226231 ACACACACACACATTGGAGATGG - Intronic
1035444347 7:158929596-158929618 AGTCACAACCACAGTGAAGAAGG - Intronic
1035737484 8:1898876-1898898 AGACACAGACACACTGGAGAAGG - Intronic
1035766220 8:2107701-2107723 ACTCACAGGCAGGGTGGGGAAGG + Intronic
1036224316 8:6945042-6945064 ACTCCCAGGCACAGTAGACGTGG + Intergenic
1036613649 8:10371763-10371785 CCTCTTAGGCACAGCGGAGAAGG - Intronic
1037648132 8:20812373-20812395 AGACACAGACACAGAGGAGAAGG + Intergenic
1040333909 8:46406458-46406480 ACTCAGAGGAACAGTGAGGAAGG + Intergenic
1040743526 8:50611261-50611283 ACTCAGAGGCAAAGGGAAGAAGG - Intronic
1042714798 8:71761033-71761055 ACACACACACACAGTGGAAAAGG + Intergenic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1046413070 8:113874445-113874467 ACTCACAGGCATTATGGAAAGGG + Intergenic
1046742795 8:117846645-117846667 ACACACAGGCCCAATGGTGATGG + Intronic
1047166680 8:122446925-122446947 TCTCACAGACACAGAGGAGAAGG + Intergenic
1047175706 8:122538365-122538387 ACTCACAGGCAGAGGTGAGAGGG + Intergenic
1047534535 8:125707356-125707378 ACACAGAGACACAGAGGAGATGG - Intergenic
1048791060 8:138104039-138104061 ACTCAGAGGTCCAGTGGAGAAGG + Intergenic
1049322760 8:142005786-142005808 ACTCACAGGCACGGTGGAGCAGG + Intergenic
1049708530 8:144053582-144053604 ATGCACAGGCACACTGCAGAGGG - Intronic
1050878755 9:10674275-10674297 AGACACAGCCACAGTAGAGAAGG - Intergenic
1051319539 9:15886940-15886962 ACTCACAGAAACAGAGTAGAAGG + Intronic
1051334964 9:16057809-16057831 CCACTCAGGCACAGTGGACACGG + Intronic
1056518091 9:87373830-87373852 ACTCAGAGACAAAGTAGAGAAGG - Intergenic
1057903689 9:98968169-98968191 ACTCACAGTAACAGTGAGGAGGG - Intronic
1058600985 9:106669993-106670015 ATTCCCAGTCACACTGGAGAGGG + Intergenic
1059366562 9:113790985-113791007 ACTCTAGGGCACAGAGGAGAGGG - Intergenic
1060032899 9:120231001-120231023 ACCCACAGGCACAGTGTGGATGG - Intergenic
1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG + Intronic
1060907709 9:127322554-127322576 ACTCACACACACAGAGGACAAGG - Intronic
1062557661 9:137122299-137122321 ACACACAGGCACAGTAGGGCTGG + Intergenic
1062642263 9:137525249-137525271 ACACACAGGCACAGTAGGGCTGG - Intronic
1185455865 X:310623-310645 AGACACAGACACAGAGGAGAAGG + Intronic
1185484941 X:475043-475065 AGACACAGACACAGAGGAGAAGG - Intergenic
1185511096 X:665823-665845 AGGCACAGACACAGAGGAGAAGG + Intergenic
1185517396 X:710390-710412 AGACACAGACACAGAGGAGACGG - Intergenic
1185523843 X:761649-761671 AGACACAGACACAGAGGAGAAGG - Intergenic
1185523896 X:762005-762027 AGACACAGACACAGAGGAGAAGG - Intergenic
1185523961 X:762340-762362 AGACACAGACACAGAGGAGAAGG - Intergenic
1185527973 X:794288-794310 AAACACAGACACAGAGGAGAAGG + Intergenic
1185530399 X:814033-814055 AGACACAGACACAGAGGAGAAGG + Intergenic
1185530454 X:814372-814394 AGACACAGACACAGAGGAGAAGG + Intergenic
1185530514 X:814711-814733 AGACACAGACACAGAGGAGAAGG + Intergenic
1185536814 X:869003-869025 AGACACAGACACAGAGGAGAAGG - Intergenic
1185536869 X:869345-869367 AGACACAGACACAGAGGAGAAGG - Intergenic
1185544002 X:926965-926987 AGACACAGTCACAGAGGAGAAGG - Intergenic
1185561197 X:1061740-1061762 AGACACAGACACAGAGGAGAAGG - Intergenic
1185561261 X:1062097-1062119 AGACACAGACACAGAGGAGAAGG - Intergenic
1185577122 X:1183143-1183165 AGACACAGACACAGAGGAGAAGG - Intergenic
1185577183 X:1183478-1183500 AGACACAGACACAGAGGAGAAGG - Intergenic
1185616827 X:1427130-1427152 AGACACAGACACAGAGGAGAAGG + Intronic
1185622037 X:1455889-1455911 AGACACAGACACAGAGGAGAAGG - Intergenic
1185629041 X:1502778-1502800 AGACACAGACACAGAGGAGAAGG + Intronic
1185630540 X:1513517-1513539 AGACACAGACACAGAGGAGAAGG - Intronic
1185639411 X:1578623-1578645 AGACACAGACACAGAGGAGAAGG + Intergenic
1185653432 X:1665828-1665850 AGACACAGACACAGAGGAGAAGG - Intergenic
1185677345 X:1859585-1859607 AGACACAGACACAGAGGAGAAGG - Intergenic
1185677403 X:1859927-1859949 AGACACAGACACAGAGGAGAAGG - Intergenic
1185698906 X:2215627-2215649 ACACACAGACACAGAGGAGAAGG + Intergenic
1185699056 X:2216613-2216635 ACACACAGACACAGAGGAGAAGG + Intergenic
1185699151 X:2217308-2217330 ACACACACACACAGAGGAGAAGG + Intergenic
1185704974 X:2260135-2260157 AGACACAGACACAGAGGAGAAGG - Intronic
1185715846 X:2341481-2341503 AGACACAGACACAGAGGAGAAGG - Intronic
1185722912 X:2396136-2396158 AGACACAGACACAGAGGAGAAGG - Intronic
1185790399 X:2924787-2924809 AGACACAGACACAGGGGAGAAGG + Intronic
1185792565 X:2938540-2938562 AGACACAGACACAGAGGAGAAGG + Intronic
1185792667 X:2939199-2939221 AGACACAGACACAGAGGAGAAGG + Intronic
1185838762 X:3369327-3369349 ATACACAGACACAGAGGAGAAGG - Intergenic
1185873412 X:3682958-3682980 AGACACAGACACAGAGGAGAAGG + Intronic
1185874936 X:3694450-3694472 AGACACAGACACAGAGGAGAAGG + Intronic
1185874989 X:3694789-3694811 AGACACAGGCACAGATGAGAAGG + Intronic
1185888237 X:3802040-3802062 AGACACAGACACAGAGGAGAAGG + Intergenic
1185918465 X:4062800-4062822 AGACACAGACACAGAGGAGAAGG + Intergenic
1186048905 X:5568404-5568426 ACTCACAGGCATGGGAGAGAAGG - Intergenic
1189438025 X:41009958-41009980 AACCAGAGGCACAGAGGAGAGGG + Intergenic
1189541293 X:41992906-41992928 GCTCACAGAAACAGTGGAAATGG + Intergenic
1190372197 X:49753482-49753504 ACACAGAGACACAGTAGAGAAGG + Intergenic
1191713338 X:64176005-64176027 AGACACAGGCAGAGTGGTGAGGG + Intergenic
1191875072 X:65787772-65787794 ACTCCCATGCAGAGTGAAGATGG + Intergenic
1194605586 X:95974662-95974684 ACACACACACACACTGGAGAAGG + Intergenic
1195283164 X:103356922-103356944 ACTTGCATGCACTGTGGAGAGGG + Intronic
1198573202 X:137980507-137980529 CCAAACAGGCACAGTGAAGACGG - Intergenic
1200085819 X:153604286-153604308 AGTCACAAACACAGAGGAGAAGG - Intergenic
1200313924 X:155110864-155110886 AATAACAGGCAGATTGGAGAAGG + Intronic
1200790892 Y:7298147-7298169 AGACACAGGCACAGAGGAGAAGG - Intergenic
1200790946 Y:7298488-7298510 AGACACAGACACAGAGGAGAAGG - Intergenic
1201236949 Y:11921128-11921150 AGACACAGACACAGAGGAGAAGG + Intergenic
1201237424 Y:11924497-11924519 ACACACAGACACAGAGGAGAAGG + Intergenic
1201280531 Y:12338496-12338518 AGACACAGACACAGAGGAGAAGG - Intergenic
1201280625 Y:12339155-12339177 AGACACAGACACAGAGGAGAAGG - Intergenic
1201283926 Y:12363181-12363203 AGACACAGACACAGGGGAGAAGG - Intergenic