ID: 1005947023

View in Genome Browser
Species Human (GRCh38)
Location 6:30602457-30602479
Sequence GGCGCCAGAGGAGGTCGCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005947023_1005947034 4 Left 1005947023 6:30602457-30602479 CCAGAGCGACCTCCTCTGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1005947034 6:30602484-30602506 AATGGAGGAGGAGGAGGAGGAGG 0: 6
1: 113
2: 1250
3: 6817
4: 15730
1005947023_1005947033 1 Left 1005947023 6:30602457-30602479 CCAGAGCGACCTCCTCTGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1005947033 6:30602481-30602503 CGGAATGGAGGAGGAGGAGGAGG 0: 1
1: 1
2: 53
3: 563
4: 3957
1005947023_1005947032 -2 Left 1005947023 6:30602457-30602479 CCAGAGCGACCTCCTCTGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1005947032 6:30602478-30602500 CCTCGGAATGGAGGAGGAGGAGG 0: 1
1: 0
2: 3
3: 61
4: 462
1005947023_1005947035 20 Left 1005947023 6:30602457-30602479 CCAGAGCGACCTCCTCTGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1005947035 6:30602500-30602522 GAGGAGGTTCGTTTCCTCCTCGG 0: 1
1: 0
2: 0
3: 6
4: 112
1005947023_1005947036 29 Left 1005947023 6:30602457-30602479 CCAGAGCGACCTCCTCTGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1005947036 6:30602509-30602531 CGTTTCCTCCTCGGCCACCTCGG 0: 1
1: 0
2: 0
3: 12
4: 212
1005947023_1005947029 -8 Left 1005947023 6:30602457-30602479 CCAGAGCGACCTCCTCTGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1005947029 6:30602472-30602494 CTGGCGCCTCGGAATGGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 129
1005947023_1005947030 -5 Left 1005947023 6:30602457-30602479 CCAGAGCGACCTCCTCTGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1005947030 6:30602475-30602497 GCGCCTCGGAATGGAGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005947023 Original CRISPR GGCGCCAGAGGAGGTCGCTC TGG (reversed) Exonic
900172422 1:1275466-1275488 GCTGCCAGAGGAAGTCCCTCCGG - Intergenic
901196596 1:7443751-7443773 GGCTCCAGAGAGGGTCCCTCAGG + Intronic
902540239 1:17149367-17149389 GGGGCCAGGGGAGGTGGCTCGGG - Intergenic
902714583 1:18263640-18263662 GCTGCCAGAGAAGGTTGCTCTGG - Intronic
903583757 1:24392493-24392515 GGTGCCACAGGAGGGAGCTCTGG - Intronic
904258387 1:29272118-29272140 TGCGCCAGAGGAGGCAGATCTGG - Intronic
913592563 1:120342413-120342435 GGCGCGAGTGGAGGTCGGTGTGG - Intergenic
915111296 1:153566019-153566041 GGGGCCAGAGGAGGCAGCTGGGG + Intronic
1068776567 10:60873991-60874013 GTGGCCAGAGGAGATTGCTCTGG - Intronic
1075738650 10:124679713-124679735 GGAGCCTGAGGAGGCTGCTCTGG - Intronic
1076990798 11:272545-272567 GGAGCCAGAGGAGATGACTCTGG - Intergenic
1078255697 11:9656793-9656815 GGGGCCAGACGTGGTGGCTCAGG - Intergenic
1079443972 11:20543034-20543056 GGGGCCAGGTGAGGTGGCTCAGG + Intergenic
1081705516 11:45180514-45180536 GGCGCCGCGGGGGGTCGCTCCGG - Intronic
1082789232 11:57335760-57335782 GGCGCGAGAGGTGGGCGCGCTGG + Exonic
1084568302 11:69943987-69944009 GGAGCCAGGGGAGGGCCCTCTGG + Intergenic
1084568504 11:69945080-69945102 GGAGCCAGGGGAGGGCCCTCTGG - Intergenic
1085165684 11:74397947-74397969 GGCTGCAGAGGAGATGGCTCGGG - Intronic
1089139793 11:116276229-116276251 GGTGCGAGAGGATGACGCTCAGG + Intergenic
1089763383 11:120745175-120745197 GGAGACAGAGGAGGTGACTCCGG + Intronic
1090876009 11:130789613-130789635 GGGGCCAGAGGAAGTCTCTCTGG - Intergenic
1096122680 12:49098330-49098352 GGAGCCAGAGGAGGCCTCACTGG - Intronic
1103400696 12:120641060-120641082 GCCGCGAGAGGAGGGCGCGCGGG + Exonic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1105891591 13:24686155-24686177 GGGGCCAGACGTGGTGGCTCAGG + Intronic
1113819567 13:113203685-113203707 GGAGCCAGAGGAGGCCCCTTTGG - Intronic
1114886616 14:26859627-26859649 GCCAACAGAGGAGGTCTCTCAGG - Intergenic
1116358582 14:43963372-43963394 GGGGCCAGAGGTGGTAGCTCAGG + Intergenic
1116799609 14:49429230-49429252 GGCACCAGTGCTGGTCGCTCTGG - Intergenic
1122059777 14:99129303-99129325 GGCCTCAGAGGAGGTCACACAGG - Intergenic
1122088164 14:99321048-99321070 AGCGCCTGAGGAGGTGGCCCGGG - Intergenic
1122197401 14:100099059-100099081 GGCGCCAGGCGTGGTGGCTCAGG + Intronic
1122370343 14:101225950-101225972 AGGGCCAGTGGGGGTCGCTCAGG - Intergenic
1122911130 14:104828007-104828029 GGCGGGAGAGGTGGTCCCTCAGG + Intergenic
1123070282 14:105639399-105639421 GGGGCCAGGGAGGGTCGCTCGGG + Intergenic
1123074872 14:105663058-105663080 GGGGCCAGGGAGGGTCGCTCGGG + Intergenic
1123089519 14:105736183-105736205 GGGGCCAGGGAGGGTCGCTCGGG + Intergenic
1123095307 14:105764343-105764365 GGGGCCAGGGAGGGTCGCTCGGG + Intergenic
1123478533 15:20610588-20610610 GGCCCCAGAGGAGGGTGCACTGG - Intergenic
1123639480 15:22389797-22389819 GGCCCCAGAGGAGGGTGCACTGG + Intergenic
1125819061 15:42612257-42612279 GGGGCCAGGCGAGGTGGCTCCGG - Intronic
1130991076 15:88876353-88876375 GGCGTCTGAGGAGGTGGCACTGG - Intergenic
1134291155 16:12903358-12903380 GGCGCGCGAGGAGGGGGCTCGGG - Intronic
1135246076 16:20858242-20858264 GGGGCCTGAGGAGCTCACTCTGG - Exonic
1136398876 16:30007130-30007152 GGCGCCAGGGGAGGGGGCCCTGG - Intronic
1138522081 16:57576796-57576818 GGCACCAGAGCAGGGTGCTCAGG + Exonic
1139147627 16:64343578-64343600 GATGCCAGAGGTGGTCCCTCTGG + Intergenic
1139252659 16:65510874-65510896 GGTGGCAAAGGAGGTCGTTCAGG + Intergenic
1141694827 16:85614304-85614326 GGCGGCCGAGGAGGTGTCTCTGG - Intronic
1143016168 17:3892410-3892432 GGCGGCAGAGGCGGGCGCTGCGG - Intronic
1147044513 17:37743224-37743246 GGCTGCCGGGGAGGTCGCTCAGG - Intronic
1147837695 17:43346638-43346660 GGGGCCTGAGGAGCTCACTCTGG + Intergenic
1150211754 17:63445818-63445840 GGGGCAAGAGGCGGTGGCTCCGG + Intronic
1152759067 17:82098821-82098843 GGCGCCAGGGGTGTTCGCACCGG + Intergenic
1154501444 18:14999731-14999753 GGCTCCAGGGGCGGTGGCTCCGG + Intergenic
1155593367 18:27453690-27453712 GGAGACAGAGGAGGTGGCTCAGG - Intergenic
1160881466 19:1322557-1322579 GGAGGCAAAGGAGGTCTCTCAGG + Intergenic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1163167462 19:15508089-15508111 GGCCCCAGAGGAGGCTTCTCGGG + Intergenic
1163358325 19:16829487-16829509 GGCGCCCGCTGGGGTCGCTCGGG + Exonic
1163777197 19:19225479-19225501 GGCTCCAGAGGAGGCCACTCTGG + Intronic
1163926165 19:20345711-20345733 GGGGCCAGGAGAGGTGGCTCAGG - Intergenic
1164728392 19:30482902-30482924 GGACCCAGAGGAGGGCGCTATGG - Intronic
1165058782 19:33194919-33194941 GGCCGGAGAGGAGGTCGGTCAGG - Intronic
1165896629 19:39145488-39145510 GGGGCCCCAGGAGGACGCTCTGG + Intronic
1166808173 19:45499231-45499253 GGAGCCAGAGGTGGCCGCACTGG + Exonic
1166859607 19:45802162-45802184 GGGGCCAGAGGAGGTGGAGCAGG - Exonic
925375350 2:3379963-3379985 GGTCCCAGAGAAGGTCCCTCCGG - Intronic
925681414 2:6425623-6425645 GGAGCCAGAGGAGGAAGCACAGG - Intergenic
925744856 2:7035099-7035121 GGCCTCAGAGGAGCCCGCTCAGG + Intronic
927217347 2:20675498-20675520 CCCGCCAGGGGAGGCCGCTCAGG + Intergenic
929589197 2:43134265-43134287 GGCGGCAGAGGAAGTGGCTGCGG - Intergenic
931601401 2:64007004-64007026 GACGCCAGAAGAGGAGGCTCAGG - Intronic
933641521 2:84766750-84766772 GGCACCAGAGGAGGAGGCTAAGG + Intronic
943635361 2:190301152-190301174 GGAGCCAGAGGTGCTGGCTCAGG + Intronic
948257345 2:236577865-236577887 GGCGCCAGCCGAGCTCCCTCTGG + Intronic
1172786114 20:37469874-37469896 GTCCCCAGAGCAGGTGGCTCCGG + Intergenic
1173140877 20:40481613-40481635 GAGGCCAGAGGAGTTAGCTCAGG + Intergenic
1174454019 20:50637079-50637101 GGCGCCCGAGGAGGCTTCTCTGG + Intronic
1175903720 20:62369903-62369925 AGCCCCAGAGGAGGTGGGTCGGG + Intergenic
1176365382 21:6029713-6029735 TGCTCCAGAGGAGGCCCCTCTGG - Intergenic
1178488138 21:33031714-33031736 GAGGCCAGAGGAGGAGGCTCGGG - Intergenic
1178720137 21:35000874-35000896 GGCACCAGAAGAAGTGGCTCAGG - Intronic
1179728801 21:43355842-43355864 GGCCCCAGACGAGGTCTCTGGGG - Intergenic
1179758136 21:43508832-43508854 TGCTCCAGAGGAGGCCCCTCTGG + Intergenic
1180005393 21:45018447-45018469 GGGGCCAGAGGCGGTCGCGGCGG + Intergenic
1181592673 22:23894722-23894744 GGGGCCCGACGAGGTCGCTGGGG + Exonic
1181626547 22:24125900-24125922 GGTGCCAGAGGAGGTGGGACAGG + Intronic
1184236708 22:43186991-43187013 GACGCCGGAGGAGGGCGCGCAGG - Exonic
1184433845 22:44458251-44458273 GGGCCCAGAGGAGGTGGCACAGG - Intergenic
950590804 3:13934820-13934842 GAGGCAGGAGGAGGTCGCTCTGG - Intergenic
950712000 3:14819641-14819663 GAGGCAGGAGGAGGTCGCTCTGG - Exonic
951558110 3:23941668-23941690 AGTGCCAGAGGAGGATGCTCAGG - Intronic
951790720 3:26480953-26480975 AGCCCCAGAGGAGGTTGCTCAGG - Intergenic
952301374 3:32106910-32106932 TGCGCCCGAGGAGGCCGCACCGG + Intronic
952714861 3:36470453-36470475 GGCTCCAGTGGAGGTAGCTGGGG + Intronic
954659873 3:52221327-52221349 GGGGCCAGAGGAGGACACTCTGG + Exonic
954661350 3:52228575-52228597 AGGGCCAGAGGCGGTCTCTCAGG + Intergenic
961446513 3:126983841-126983863 GGGGCCGGAGGAGGTCGTGCAGG + Intergenic
962687915 3:137865307-137865329 GGGGCCAAAGGAGATCTCTCAGG + Intergenic
968509031 4:987330-987352 GGCCCCAGAGGAGGGAGCTCCGG - Intronic
970202900 4:13627547-13627569 GGCGCCGGAGGAGGCGGCTGCGG + Exonic
971328215 4:25661667-25661689 GGGGCCAGGCGAGGTGGCTCAGG - Intronic
982076410 4:151741667-151741689 GAGGCCAGACGAGGTCCCTCAGG + Intronic
985590067 5:759918-759940 GGGGCCCGAGGGGGTCGCTGAGG + Intronic
986458106 5:7940663-7940685 GCCTCCAGAGGAGGAGGCTCAGG - Intergenic
986556868 5:9018753-9018775 GCCTCCAGAGGAGGCAGCTCAGG + Intergenic
989480550 5:41925545-41925567 GGCTCCAGGGGAGGTCCCTCCGG - Intronic
989643211 5:43603232-43603254 GCCGCGAGAGGACGTCGCGCTGG - Intronic
989983051 5:50666450-50666472 GGCGCGAGTGGAGGTCGGTGTGG + Intronic
990272751 5:54162156-54162178 GGCAGCAGAGGAGGTCCCACAGG - Intronic
992591042 5:78295688-78295710 GGCCCCAGAGTAGCTCTCTCCGG + Intergenic
993168275 5:84384217-84384239 GGGGCCGGAGGCGGTCCCTCCGG - Intronic
996862725 5:128083968-128083990 GGCGCCGGAGGAGGGCGCCGTGG - Exonic
997485167 5:134225483-134225505 GGCGCCAGACGAGGTGGCAGGGG - Intronic
1002896783 6:1384208-1384230 GGGGCCTGAAGAGGTCACTCCGG - Intergenic
1003765182 6:9228456-9228478 GGAGCCAGGGGAGCTCTCTCAGG + Intergenic
1005947023 6:30602457-30602479 GGCGCCAGAGGAGGTCGCTCTGG - Exonic
1015298577 6:131627911-131627933 GGCGTGAGAGGAGGTTGCCCAGG + Intronic
1015367632 6:132414795-132414817 GGCGTCAGAGGCGGTTACTCTGG + Intergenic
1015904960 6:138107470-138107492 GGCTCCCGAGGACGCCGCTCCGG + Exonic
1017874879 6:158516252-158516274 GGCGCCAGCGGCAGCCGCTCAGG + Intergenic
1019323217 7:424966-424988 GGCCCCAGGGGACGTCCCTCAGG + Intergenic
1019474171 7:1236151-1236173 GGCGCCCGAGGCGTGCGCTCCGG - Exonic
1024238665 7:47416871-47416893 TGCTCCAGAGGAGGTGACTCAGG - Intronic
1034339011 7:150340669-150340691 GGCGCGGGAGGAGGCGGCTCGGG - Exonic
1036406042 8:8456038-8456060 GGCGCCACAGGAGCTGGCCCTGG - Intergenic
1049376137 8:142290045-142290067 GGCTCCTGAGGAGGAAGCTCGGG + Intronic
1049613918 8:143568144-143568166 GGCGGCAGCAGAGGTGGCTCAGG + Exonic
1053273036 9:36763094-36763116 GGCGCCTGGGGAGCTCCCTCGGG + Intergenic
1057041038 9:91847527-91847549 GGCGCCAGAGGAGGCCCTGCAGG + Intronic
1060090994 9:120743311-120743333 GGGGCCAGATGCGGTGGCTCAGG + Intergenic
1060661335 9:125406996-125407018 TGCGCCAGAGAAGGACGCTTCGG + Intergenic
1189324682 X:40105381-40105403 GGGGCCAGCGGAGGCCGCTCGGG - Intronic
1190230273 X:48576365-48576387 GGAACCAGAGGAGGTGGCTTTGG + Exonic
1191797288 X:65034829-65034851 GGCGCCAGAGGAGGAGGAGCAGG + Intergenic
1200178660 X:154136849-154136871 GGCGCCAGAAGAGGGCGCCCGGG + Intergenic
1201313335 Y:12618143-12618165 GGGGCCAGACGCGGTGGCTCAGG + Intergenic