ID: 1005947097

View in Genome Browser
Species Human (GRCh38)
Location 6:30602669-30602691
Sequence GTCCCCATGGAGGCCCTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005947097_1005947106 18 Left 1005947097 6:30602669-30602691 CCCACCAGGGCCTCCATGGGGAC 0: 1
1: 0
2: 6
3: 20
4: 286
Right 1005947106 6:30602710-30602732 GAGAGACAGTATCAGCTACCAGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005947097 Original CRISPR GTCCCCATGGAGGCCCTGGT GGG (reversed) Exonic