ID: 1005947097

View in Genome Browser
Species Human (GRCh38)
Location 6:30602669-30602691
Sequence GTCCCCATGGAGGCCCTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005947097_1005947106 18 Left 1005947097 6:30602669-30602691 CCCACCAGGGCCTCCATGGGGAC 0: 1
1: 0
2: 6
3: 20
4: 286
Right 1005947106 6:30602710-30602732 GAGAGACAGTATCAGCTACCAGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005947097 Original CRISPR GTCCCCATGGAGGCCCTGGT GGG (reversed) Exonic
900029514 1:360741-360763 GTACCTTTGGAGGCCCAGGTGGG - Intergenic
900050115 1:589512-589534 GTACCTTTGGAGGCCCAGGTGGG - Intergenic
900109230 1:998642-998664 GTCCCCCCGGAGGCTCAGGTGGG - Intergenic
900403617 1:2482980-2483002 GCCCCCTTGGAGCCCCTGGGTGG + Intronic
900408944 1:2504260-2504282 GTGCCCACGGAGCCCCTGGGAGG + Exonic
900516724 1:3085690-3085712 GTCCTCCTGGAGGCCATGGAAGG + Intronic
900791481 1:4683814-4683836 GTCCCCAGAGAGGCCAGGGTGGG + Intronic
902451804 1:16501041-16501063 GTCCCTACCCAGGCCCTGGTGGG + Intergenic
902501144 1:16912624-16912646 GTCCCTACCCAGGCCCTGGTGGG - Intronic
903685767 1:25130811-25130833 GTGCCCCTGAAGGCCCTGCTGGG + Intergenic
905286585 1:36884367-36884389 CTCCCCAAGGAGGCCATGCTCGG + Intronic
905912340 1:41662964-41662986 GAGCCCAGGGAGGCCCTGGCAGG - Intronic
907671271 1:56476982-56477004 GTACCCCTCGAGGGCCTGGTGGG + Intergenic
910289049 1:85582158-85582180 GACCCCATGGAGGACCAGGACGG + Exonic
913807823 1:122829088-122829110 GTCCTCATTGAGGCCTTCGTTGG + Intergenic
913829343 1:123214393-123214415 GACCCCTTGGAGGCCTTCGTTGG + Intergenic
913841906 1:123438661-123438683 GTCCCCTTTGAGGCCTTCGTTGG + Intergenic
913860857 1:123779578-123779600 GACCCCTTGGAGGCCTTCGTTGG + Intergenic
913874745 1:124029534-124029556 GACCCCTTTGAGGCCCTCGTTGG + Intergenic
913895491 1:124400294-124400316 GTCCTCATTGAGGCCTTCGTTGG + Intergenic
913907318 1:124612372-124612394 GACCCCTTGGAGGCCTTCGTTGG + Intergenic
913907431 1:124614411-124614433 GACCCCTTGGAGGCCTTCGTTGG + Intergenic
914490920 1:148149632-148149654 GTCCACATGCAGCCCCTGGGTGG - Intronic
916572335 1:166038766-166038788 GTCCCTGTGGAGGGCATGGTGGG - Intergenic
916712671 1:167425586-167425608 GTCCCCATAGTGACCCTGGTTGG - Exonic
918041557 1:180916899-180916921 GTCCCCAGGACGGCCCTGCTGGG + Exonic
918342447 1:183578867-183578889 GGCTCCACAGAGGCCCTGGTGGG + Intronic
921389619 1:214605590-214605612 GTCCACATGCAGCCCCTGGGGGG + Intronic
921747193 1:218752242-218752264 GTCCCCAGAGACGCCCTGGAAGG - Intergenic
922116172 1:222617367-222617389 GCCCCCAAGGAAGCCCTGGGAGG + Intergenic
923105285 1:230849489-230849511 GTGCCCACGGAGGCTCTGCTGGG + Intronic
924567916 1:245213290-245213312 GCTCACATGGAGACCCTGGTGGG + Intronic
1064210923 10:13359929-13359951 GGCCAGATGGGGGCCCTGGTAGG + Intergenic
1065529932 10:26658716-26658738 GTCCCCAAGGTGGCAGTGGTGGG - Intergenic
1066849727 10:40087520-40087542 GACCCCTTGGAGGCCTTCGTTGG + Intergenic
1066864011 10:40371380-40371402 GACCCCATTGAGGCCATTGTTGG + Intergenic
1066871757 10:40524957-40524979 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066875922 10:40607774-40607796 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066881046 10:40709966-40709988 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066888151 10:40849209-40849231 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066897580 10:41035770-41035792 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066911509 10:41308839-41308861 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066914307 10:41363869-41363891 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066915004 10:41377451-41377473 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066919988 10:41475648-41475670 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066920094 10:41477686-41477708 GACCCCATTGAGGCCATCGTTGG + Intergenic
1067415008 10:46096151-46096173 GTCCCCATGGTGGTCCTGTAGGG - Intergenic
1067739848 10:48887184-48887206 GGCACCATGGAGGCTGTGGTGGG + Intronic
1071456832 10:85857504-85857526 GTCCCCATGGAGGGCTGGGGTGG - Intronic
1072539879 10:96390294-96390316 GTCACCATGAAGGGCTTGGTAGG - Intronic
1073514467 10:104064506-104064528 GTCCCCATGGAGGACCCCGCGGG + Exonic
1076363760 10:129909187-129909209 CTCCCCATGGCTGCCCTGGATGG + Intronic
1076435638 10:130439284-130439306 GTCCCCAGGGAGGCCTTCCTGGG + Intergenic
1076555270 10:131317470-131317492 GTCCAGATTGAGCCCCTGGTGGG + Intergenic
1076675482 10:132145590-132145612 GAACCCCTGGAGGCCCTGGCAGG + Intronic
1077102611 11:828844-828866 GTCGCTCTGGAGACCCTGGTCGG - Exonic
1077296863 11:1830446-1830468 AGCCTCATGGAGACCCTGGTGGG - Intronic
1077302889 11:1855299-1855321 GTCCCCAGGAAGGCCCAGGCTGG + Intronic
1077360742 11:2139272-2139294 TGCCCGATGGAGGCGCTGGTGGG + Intronic
1077959603 11:7061008-7061030 GTCACTTGGGAGGCCCTGGTAGG - Intronic
1079388080 11:19998395-19998417 TACCGCATGAAGGCCCTGGTGGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1080847249 11:36037079-36037101 GTCCTCCTGGGTGCCCTGGTAGG + Intronic
1083254112 11:61485886-61485908 GTCCCCAGGGAGGGCCTGTGAGG - Exonic
1083363574 11:62128147-62128169 GTCCCCATGGTGGCTCTGTCTGG - Exonic
1083774480 11:64887832-64887854 TTACCCAAGGTGGCCCTGGTGGG - Intronic
1084948523 11:72652028-72652050 GTGGCCATGGTGGCCTTGGTGGG + Intronic
1087904163 11:103676134-103676156 GTTCCCAAGGAGACCATGGTTGG + Intergenic
1089085917 11:115816553-115816575 GTTTCCCTGGAGGCTCTGGTTGG - Intergenic
1089333990 11:117709922-117709944 GTCTCCAAGGAGGTCCTGGCTGG - Intronic
1089398514 11:118151313-118151335 GTCCCCATGGTGGCAATGGCAGG - Intronic
1090647713 11:128778965-128778987 TTCCCCAAGGAGGGGCTGGTTGG - Intronic
1091621600 12:2093305-2093327 GTACCAGTGGAGCCCCTGGTAGG + Intronic
1094832127 12:34305124-34305146 GTCCCCATGCAGGGACTGCTGGG - Intergenic
1094832691 12:34307678-34307700 GTCCCCACGGAGGGGCTGCTGGG - Intergenic
1098067273 12:66632015-66632037 GCCACCTTGGAAGCCCTGGTAGG - Intronic
1100980233 12:100157543-100157565 GGCCCCCTGCAGGGCCTGGTGGG + Intergenic
1101723381 12:107370270-107370292 ATCCCCATGGTGGCCCATGTCGG + Intronic
1102143571 12:110637099-110637121 GTCCCCATGGAGGCCTGAGTTGG + Intronic
1103446133 12:120996479-120996501 GTCCCTAGGGAGGCCCTGTGGGG + Intronic
1103540648 12:121664096-121664118 CTCCCCTTGCAGGCCCGGGTGGG - Intronic
1104490037 12:129186133-129186155 ATCCCCATGGGGGCCTTGGGTGG - Intronic
1105258248 13:18759504-18759526 GCCCCCATGGCTGCCCTCGTGGG - Intergenic
1105260906 13:18778804-18778826 GCCCCCATGGCTGCCCTCGTGGG - Intergenic
1106031648 13:26010441-26010463 GTCCCCATGTGGGGCCTGGCTGG + Intronic
1106677514 13:31976625-31976647 GACACCATGGTGGCCCTGGAAGG - Intergenic
1108440494 13:50448351-50448373 GACACCAGGGAGGCCCAGGTGGG + Intronic
1108502902 13:51084466-51084488 GTCGCCATGGGGGCCATGGGTGG + Intergenic
1113185679 13:107683668-107683690 GTCCCCAGAGAGGCCGTGGCAGG + Intronic
1113331367 13:109331009-109331031 GTGCACAAGGAGGCCCTGGGAGG + Intergenic
1114261525 14:21040199-21040221 GTCCTCAGCGAGGCCTTGGTTGG - Intronic
1116918204 14:50545696-50545718 GTATCCATGTCGGCCCTGGTTGG + Intronic
1118614040 14:67562996-67563018 ATCCTCATGGTGGCCCTGGCAGG + Intronic
1118796996 14:69152901-69152923 GTCCCCATGCAAGCCCCGCTGGG + Exonic
1119535057 14:75396117-75396139 GTCCCCAGGGAAGCCCAGGAAGG - Intergenic
1119774953 14:77242559-77242581 GTCCCCTTGGAGTCTCTGTTGGG - Intronic
1121019445 14:90570163-90570185 GACCTCAGGGAGGCCCTGCTAGG - Intronic
1122272687 14:100575429-100575451 GTCCCCATGGAGACACTGGGGGG + Intronic
1202853965 14_GL000225v1_random:38153-38175 GCCACCATGGAGGGCCTGGCGGG + Intergenic
1123450516 15:20356927-20356949 GACCCCCCGCAGGCCCTGGTGGG - Intergenic
1124890341 15:33726443-33726465 GTCCCCACAGAAGACCTGGTTGG + Exonic
1125966511 15:43879663-43879685 TTCCCCATGGTGGCCCAGGAAGG + Intronic
1128032691 15:64495646-64495668 CTCCACCTGGAGGCCCAGGTGGG - Intronic
1128293515 15:66497562-66497584 GTCACCACAGAGGCCCAGGTTGG + Intronic
1128651187 15:69414697-69414719 GGCCCCTTGGAGGCCCAGGCGGG - Intronic
1128977967 15:72167177-72167199 TTCCCCATGGTGGCCATGCTGGG - Intronic
1129722707 15:77886979-77887001 AGCCCCATGGTGGCCCTGGCAGG - Intergenic
1130485219 15:84394960-84394982 GGCCCCCTGCAGGGCCTGGTGGG - Intergenic
1131265086 15:90910968-90910990 GTCCCCATGCAGACCCAGGAGGG - Intronic
1131344829 15:91636921-91636943 GTCCCCTGGGAGGTCCTGGCTGG - Intergenic
1131822471 15:96286789-96286811 AGTCCCATGGATGCCCTGGTGGG + Intergenic
1132328852 15:100996333-100996355 GTCACCATGGGGGCCTTGCTGGG - Intronic
1132464914 16:72820-72842 GGCCCGACGGAGGACCTGGTGGG + Intronic
1132493481 16:247921-247943 GTCCCCATGGAGGCACTGCGGGG + Intronic
1132525755 16:413739-413761 GCAGCCATGGGGGCCCTGGTGGG - Intergenic
1132701579 16:1224494-1224516 GTCCCAATGGGGGCCCGGGGAGG - Intronic
1133130339 16:3672860-3672882 CTCCCCAGGCAGGCCCTGGCTGG + Intronic
1134132185 16:11657377-11657399 GTCCCCAAGGAGGTCTTGGGAGG + Intergenic
1136685258 16:31990272-31990294 GGTCCCAGGGAGGGCCTGGTGGG + Intergenic
1136707762 16:32202892-32202914 GTCCACATGCAGTCCCTGGGGGG - Intergenic
1136760147 16:32726519-32726541 GTCCACATGCAGTCCCTGGGGGG + Intergenic
1136785871 16:32933807-32933829 GGTCCCAGGGAGGGCCTGGTGGG + Intergenic
1136807957 16:33143867-33143889 GTCCACATGCAGTCCCTGGGGGG - Intergenic
1136883900 16:33919997-33920019 GGTCCCAGGGAGGGCCTGGTGGG - Intergenic
1138555987 16:57771502-57771524 GTCCCCATGCTGGTCCTGGAGGG - Intronic
1141206485 16:81936931-81936953 GTCCCCGTGGAGGCACATGTAGG + Intronic
1141636354 16:85315976-85315998 GTGCCCATGGTGCCCCTGCTGGG + Intergenic
1141827400 16:86490435-86490457 GTCCTCATGGAGGGCTAGGTTGG + Intergenic
1142441035 16:90097741-90097763 GTGTCCATGGAGGGGCTGGTGGG + Intergenic
1203088108 16_KI270728v1_random:1195469-1195491 GGTCCCAGGGAGGGCCTGGTGGG + Intergenic
1142766147 17:2065339-2065361 GCCACCATGGAGGCCCAGGTGGG - Intronic
1143634342 17:8155913-8155935 GGCCGGAGGGAGGCCCTGGTAGG - Intronic
1145191539 17:20844324-20844346 GTCCACATGCAGCCCCTGGGGGG - Intronic
1147146203 17:38485953-38485975 GGTCCCAGGGAGGGCCTGGTGGG + Intronic
1147324407 17:39663415-39663437 GTCCCCCAGGAGGCCCTGGGAGG - Exonic
1147332703 17:39708254-39708276 AACCCCAGGGAGGCCCTGGGGGG + Intronic
1147363232 17:39944333-39944355 GTGCCCGTGGAGGCCTTTGTGGG + Exonic
1148867214 17:50634931-50634953 GGCCCCATGGACGCCCTGTGCGG + Exonic
1150323218 17:64233984-64234006 GCGTCCATGGAGGCCCTGGCGGG - Intronic
1152337925 17:79708407-79708429 GGCCCCCCGCAGGCCCTGGTGGG + Intergenic
1152908749 17:82984925-82984947 GTCCCCTTCGTGGCCCTGCTGGG + Intronic
1152950243 17:83225819-83225841 GTACCTTTGGAGGCCCAGGTGGG + Intergenic
1154425108 18:14265987-14266009 GCCCCCATGGCTGCCCTCGTGGG + Intergenic
1154432801 18:14321227-14321249 GCCCCCATGGCTGCCCTCGTGGG + Intergenic
1157473935 18:48009528-48009550 GTACAGATGGAAGCCCTGGTCGG + Intergenic
1157717134 18:49895658-49895680 GACCCCATGGAGGGCCTCCTTGG - Intronic
1158517587 18:58143664-58143686 GTCCCCAGAGAGGCCGTGGATGG + Intronic
1160236072 18:77087778-77087800 GTCCCCAGGGCGACCCTGGGAGG - Intronic
1160804980 19:988678-988700 CTGCCCCTGGAGGCCCTGGGAGG + Intronic
1160994665 19:1877112-1877134 GTCCACATGCAGCCCCTGGGTGG + Exonic
1161162658 19:2769672-2769694 GTCCCCAAGAAGTCCCTGGGGGG - Intronic
1161616641 19:5274517-5274539 GTGCCCATGGGTGCCGTGGTGGG - Intronic
1163348083 19:16757356-16757378 CTCCGCATGGAGGGGCTGGTTGG + Intronic
1164534325 19:29073828-29073850 GTCCCCATTGCTGCCTTGGTGGG - Intergenic
1164576761 19:29409613-29409635 TGGCCCATGGAGGGCCTGGTAGG + Intergenic
1165172784 19:33905904-33905926 GTCCCCAGGGACACCCTGGCAGG - Intergenic
1165792549 19:38500663-38500685 GTGCCCTTGGAGGACCTTGTGGG + Exonic
1166248410 19:41547616-41547638 GTCCTCATGAAGATCCTGGTTGG - Intergenic
1166552626 19:43676512-43676534 CTCCCCAGGGAGGCCCTGAGTGG - Intergenic
1167080421 19:47273681-47273703 TCTCCCATGGAGGCCCTGGGCGG + Intergenic
1167792558 19:51690747-51690769 TTCCCCAAGGAGACACTGGTTGG + Intergenic
1167998608 19:53426541-53426563 GTCCCCATGGGTGGCCTGTTAGG + Intronic
1168008730 19:53512652-53512674 GTCCCCATGGGTGGCCTGTTAGG + Intergenic
1168641425 19:58034193-58034215 GTCCCGATGGACGCTCTGGCGGG - Intronic
927698394 2:25252392-25252414 GCCCCGCTGGAGGGCCTGGTTGG + Intronic
933233714 2:79840684-79840706 GTCCCCGGGGAGGCCAAGGTGGG + Intronic
934490391 2:94758520-94758542 ATCCCCAAGGAGTGCCTGGTGGG - Intergenic
936970257 2:118169967-118169989 TTCCCCATGGAGGACCTTCTTGG + Intergenic
937166232 2:119820509-119820531 TCCCCCAAGGAAGCCCTGGTGGG + Intronic
937302611 2:120852418-120852440 GTCCCCCTGGCACCCCTGGTGGG - Intronic
937873475 2:126803059-126803081 GGCCTCATGGAGGCCCAGGAGGG + Intergenic
938383975 2:130851747-130851769 GTGTCCATGGAGGCCCCGGGAGG - Intronic
938739589 2:134218646-134218668 GTACCTTTGGAGGCCCAGGTTGG + Intronic
942817763 2:180072007-180072029 CTACCCACAGAGGCCCTGGTTGG - Intergenic
946684875 2:222257818-222257840 GACCCTGGGGAGGCCCTGGTGGG - Intronic
947942400 2:234069654-234069676 GCCACCATGGATGCCCTGGAGGG - Intronic
948573722 2:238936337-238936359 GTCCCCACGCTGACCCTGGTCGG - Intergenic
948937970 2:241180738-241180760 GTCCACATGGAGGCACTGGTCGG + Intronic
1168955533 20:1831999-1832021 CTCCCCATAGATGCCCTGGCTGG - Intergenic
1169770299 20:9192613-9192635 CTCCCTATGGAGACCCTGGGAGG - Intronic
1170485010 20:16807212-16807234 CTCCCCATGGAGGTCTTGGCTGG - Intergenic
1171205789 20:23279920-23279942 GTCACCAGGGAAGCCCTGGTGGG - Intergenic
1171488198 20:25498640-25498662 GTCCCCATGAAGGGCCTGCAGGG - Intronic
1172792914 20:37518660-37518682 GTCCCCATCTAGGTCCTGGCTGG - Exonic
1173426176 20:42945568-42945590 GGCACCTTGGAGGCCCTGATGGG - Intronic
1173656063 20:44701084-44701106 GGCCACATGCAGGCCCTGCTTGG + Intergenic
1173755458 20:45511762-45511784 CTCCCCATGTAGCCCTTGGTAGG + Intergenic
1176132426 20:63501985-63502007 GCCCCCAGGGAAGCCCTGATTGG - Intergenic
1176216321 20:63949642-63949664 GTGGCCCTGGAGGCCGTGGTGGG + Intronic
1176388490 21:6151485-6151507 GCCCCCATGGAGGGCCTTCTGGG - Intergenic
1176722164 21:10401870-10401892 GTCTCCATGGGAGCCCAGGTGGG - Intergenic
1178479832 21:32970178-32970200 ATCCCCATGGATGCATTGGTTGG - Intergenic
1179053930 21:37914612-37914634 GTCTCCATGGCGACCCAGGTGGG - Intronic
1179734982 21:43386763-43386785 GCCCCCATGGAGGGCCTTCTGGG + Intergenic
1180303351 22:11054632-11054654 GTCTCCATGGGAGCCCAGGTGGG - Intergenic
1180702817 22:17790961-17790983 GCACCCATGGAGGCCAGGGTGGG - Intronic
1181120755 22:20667732-20667754 GTCCACATGCAGCCCCTGGGGGG + Intergenic
1181333720 22:22114759-22114781 GTCCACATGCAGCCCCTGGGGGG + Intergenic
1183897360 22:40980044-40980066 GTCCCCACAGCGGGCCTGGTGGG - Intergenic
1184146491 22:42614586-42614608 GTCCCTCTGGCGGCCCTGGGAGG - Intronic
1184160927 22:42696925-42696947 GGGCCCAGGGAGGACCTGGTGGG - Intronic
1184211046 22:43035737-43035759 GTCTCCATGGCAGCCCAGGTGGG + Intergenic
1184418642 22:44366568-44366590 ATCCCCTTGGCTGCCCTGGTGGG + Intergenic
1184684064 22:46088097-46088119 GTCCCCATGGAAACCACGGTGGG + Intronic
1185245745 22:49771827-49771849 GTCCCCAGGGAGGCCGCTGTCGG - Intergenic
1185383754 22:50522282-50522304 GACCCCGTGGTGGCCCTGATGGG + Intronic
949659772 3:6264998-6265020 GTCCCCATGTAGGGCATTGTGGG - Intergenic
949898054 3:8785005-8785027 GTCCCTGTGGAAGCCCTGGCAGG - Intronic
950097361 3:10337903-10337925 ATCCCCCTGGAGACCATGGTGGG + Intronic
950419854 3:12892481-12892503 GTCCCCGTGGAGGTCCTGGGTGG - Intergenic
950419878 3:12892545-12892567 GTCCCTGTGGAGGTCCTGGGGGG - Intergenic
950419903 3:12892602-12892624 GTCCCCTTGGAGGTCCTGGGTGG - Intergenic
950419926 3:12892667-12892689 GTCCCCATGGAGGTCCTGGGTGG - Intergenic
950473057 3:13198358-13198380 GTCCCCCTGGAGGTTCTGGGTGG + Intergenic
950665385 3:14492055-14492077 GTCCCCAAGGGGGCCTTGGTGGG + Exonic
951555602 3:23917541-23917563 GTCCCCAAGGAGGACCTGAAAGG - Intronic
952898381 3:38094289-38094311 GTCCCCAGGGCAGCCCTGGTTGG - Intronic
954672317 3:52297685-52297707 CTCCCCAAGGAGGCAGTGGTGGG - Intergenic
954798610 3:53174373-53174395 GTCCCCATGGAGGCTGTGTGGGG + Intronic
957062215 3:75491159-75491181 GTCCCAGTGGAAGCCCTGGAAGG + Intergenic
961509747 3:127393598-127393620 CTTCCCCTGGGGGCCCTGGTAGG - Intergenic
963171709 3:142257744-142257766 CTCCTCAAGGAGGCCCAGGTGGG - Intergenic
964124521 3:153222421-153222443 TTCACCATGTTGGCCCTGGTTGG - Intergenic
967073050 3:185978812-185978834 TGCCGCATGGAGGCCCAGGTGGG + Intergenic
969307161 4:6332432-6332454 GTCCCCATAGCGGTCCTTGTGGG + Intronic
969716592 4:8871058-8871080 GGCCCCCAGGAGCCCCTGGTTGG - Intronic
973290733 4:48467903-48467925 GTCACCATGGATGTCGTGGTGGG + Intergenic
976080086 4:81345946-81345968 GTCCCAAGGGAGGCCCTGGTGGG + Intergenic
979986786 4:127325406-127325428 GTCCCCATGGCTGCCCTCGTAGG - Intergenic
985537125 5:471871-471893 GTCCCCATTGAGTCCCTGGTGGG - Exonic
985678358 5:1243738-1243760 GTCCCCAAGGAGGCCCTGACTGG + Exonic
985820839 5:2159218-2159240 TTCCCTCTGGAAGCCCTGGTTGG + Intergenic
985990611 5:3557454-3557476 GCCCTCATGGAGTCCCTTGTGGG + Intergenic
986672510 5:10155292-10155314 ATACCCATGGAGGCCATGCTGGG + Intergenic
987562367 5:19540505-19540527 GTCCTCATGGAGGACCTGTAAGG - Intronic
990571887 5:57087252-57087274 GAACACATGGAGGCCATGGTGGG - Intergenic
991674137 5:69075308-69075330 GTGCCCGTGGAGGCCTTCGTGGG + Intergenic
999340155 5:150763245-150763267 GGCAACAGGGAGGCCCTGGTTGG + Intergenic
1001406527 5:171481002-171481024 GTCCCAGTGGAGCCCCAGGTGGG - Intergenic
1001848370 5:174941315-174941337 GTCCCCAGGCAAGCCCTGCTGGG + Intergenic
1001901274 5:175432328-175432350 GTCCCCAAGGACCCCCTTGTGGG + Intergenic
1002176718 5:177404883-177404905 ACCCCCATGGAGGCACGGGTTGG + Exonic
1002307371 5:178291718-178291740 GTCCCCATGCAGGTGCTGGTGGG + Intronic
1002531325 5:179847624-179847646 CTCACCAGAGAGGCCCTGGTAGG - Intronic
1002744476 5:181459631-181459653 GTACCTTTGGAGGCCCAGGTGGG + Intergenic
1002763279 6:218202-218224 GTGCCTTTGGAGGCCCTGCTGGG + Intergenic
1003174764 6:3746409-3746431 GGCCCCATGGGAGCCCTGGCAGG + Intronic
1005946994 6:30602372-30602394 GTCCTCACGAAGGCCCTGGTGGG - Exonic
1005947097 6:30602669-30602691 GTCCCCATGGAGGCCCTGGTGGG - Exonic
1006078304 6:31548380-31548402 GTCCCCATGGCGGTCCTGGTGGG - Exonic
1006947292 6:37793201-37793223 GCCCCCAGGGAGGACCTGGGAGG - Intergenic
1007416216 6:41692784-41692806 GACCCCATGAAGGTCCTGGTAGG + Intronic
1007467624 6:42065656-42065678 GCCCCCAGGGAAGCCCTGATGGG - Intronic
1007476474 6:42122902-42122924 GTCCCCAGGGGTGCCCTGGGCGG - Intronic
1007790697 6:44306592-44306614 GTCCTCAGGGAGGCCCAGGGTGG - Intronic
1009254524 6:61367052-61367074 GACCGCATGGAGGCCTTCGTGGG + Intergenic
1011565100 6:88665331-88665353 GTCCCCAGAGAAGCCCTGGAAGG + Intronic
1011766846 6:90629543-90629565 ATCCCCCAAGAGGCCCTGGTGGG - Intergenic
1015796400 6:137016240-137016262 GTCCCCATGGAGCCCCAGCTGGG - Intronic
1015978549 6:138815964-138815986 CTCCCCATGGAGTCACTGGAAGG + Intronic
1017600189 6:156071884-156071906 GTGCACATGGGGGCACTGGTTGG - Intergenic
1017868914 6:158469690-158469712 ATCCACATGGAGGCCATAGTTGG + Intronic
1017882562 6:158572086-158572108 GTGGCCATGCAGGCCCTGCTGGG + Intronic
1018397819 6:163393473-163393495 GTTTCCATGAAGGCCCTGGAAGG + Intergenic
1018705781 6:166462248-166462270 CTCCCCATGGAACCCCCGGTGGG + Intronic
1018827555 6:167421265-167421287 GGCCCCCTGGAGCCCCTGGGCGG + Intergenic
1019064773 6:169287913-169287935 GTCCCCATGGAGCCTCTGGAGGG - Intergenic
1019064831 6:169288143-169288165 GCCTCCATGGAGCCCCTGGAGGG - Intergenic
1019249387 6:170733172-170733194 GTACCTTTGGAGGCCCAGGTGGG + Intergenic
1019355957 7:579108-579130 CACCCCATGGAGGCCCCGGACGG + Intronic
1019358239 7:592069-592091 CACCTCACGGAGGCCCTGGTGGG - Intronic
1019437106 7:1028039-1028061 GTCCCCGAGCAGGCCCTGGACGG - Intronic
1019592791 7:1844176-1844198 GTCCCCGGGGAGCCCCTGGCAGG - Intronic
1019786785 7:2982256-2982278 TTCTCCATGGCGGCCCTGGCTGG - Intronic
1022141939 7:27500202-27500224 GCCCCCATGCAGCCCCTGGACGG - Intergenic
1023899896 7:44467576-44467598 GTCCCCATTGAGGCCCGGCAGGG + Intronic
1024083244 7:45873092-45873114 GTCCCCACTTAGGCCCAGGTAGG + Intergenic
1024748058 7:52430607-52430629 GTCCCCATGGATGCTGTGGAAGG - Intergenic
1025370168 7:59003630-59003652 GACCGCATTGAGGCCTTGGTTGG + Intergenic
1025388186 7:59323509-59323531 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1025395679 7:59456700-59456722 GACCGCATGGAGGCCTTCGTTGG + Intergenic
1032594269 7:133223808-133223830 ATCCCCATGTGGGACCTGGTGGG - Intergenic
1035462276 7:159049431-159049453 ATACCCACGGAGGCCCTGGAGGG - Intronic
1035498710 8:74475-74497 GTACCTTTGGAGGCCCAGGTGGG - Intronic
1035741000 8:1928690-1928712 CTGCCCATGGAGGGCGTGGTGGG + Intronic
1036848430 8:12185340-12185362 GGCACCATGTAGGCCCGGGTGGG + Intronic
1036869790 8:12427621-12427643 GGCACCATGTAGGCCCGGGTGGG + Intronic
1037722973 8:21460262-21460284 GTCTCCTTGGAGGCCTTGCTTGG - Intergenic
1037725270 8:21478225-21478247 GTTTCCATGAAGCCCCTGGTTGG + Intergenic
1039904995 8:41780129-41780151 GTTCCTAGGGAGGCCCTGGGAGG - Intronic
1040295830 8:46148592-46148614 GTCCCCAGGGCTGTCCTGGTCGG - Intergenic
1043621714 8:82201303-82201325 GTTCTCATGGAGGCCCTGCCAGG + Intergenic
1044768033 8:95597467-95597489 TTCCCCATGTTGGCCATGGTTGG + Intergenic
1047664453 8:127075318-127075340 GTCCCCATGGTGGGCCTAATAGG + Intergenic
1048865848 8:138760947-138760969 GACCCCAGGGAGGGCCTGGAGGG + Intronic
1049217269 8:141413955-141413977 GTGTCCCTGGAGGCTCTGGTGGG + Intronic
1049245719 8:141561271-141561293 GTGCCCATGGAGGCCCTGGATGG + Intergenic
1049918018 9:337167-337189 GTCCCCATGGTGGCAGTGTTGGG - Intronic
1049958044 9:711454-711476 CTCCCCATGGAGGAAGTGGTGGG - Exonic
1052860723 9:33436328-33436350 GTCCCCAAGCCGTCCCTGGTTGG - Intergenic
1057802363 9:98198163-98198185 GGCCCCGTGGTGGCCCTGGCTGG - Intergenic
1058781185 9:108337146-108337168 ATCCCCAAGGTGGCCCTGTTTGG - Intergenic
1060657045 9:125379131-125379153 CTCCCCATGGAGGGCCTGATGGG + Intergenic
1060941500 9:127545481-127545503 GTCACCAGGGAGGCCATGGTGGG + Intronic
1062049039 9:134437813-134437835 GGCCACACGCAGGCCCTGGTGGG + Intronic
1062407736 9:136404898-136404920 CTCCCCACGGATGCCCTCGTGGG + Intronic
1062551577 9:137089896-137089918 GGCGCCATGGAGACCTTGGTGGG + Intronic
1062554252 9:137106910-137106932 GCCCACGTGGAGGCCCTGGGTGG + Intronic
1062558305 9:137127284-137127306 GGCGCCATGGAGACCTTGGTGGG - Intergenic
1203610287 Un_KI270748v1:90125-90147 GTACCTTTGGAGGCCCAGGTGGG + Intergenic
1190977078 X:55416427-55416449 GTCAGCCTGAAGGCCCTGGTGGG - Intergenic
1198995756 X:142571786-142571808 GCCTGGATGGAGGCCCTGGTTGG - Intergenic
1199510212 X:148613256-148613278 ATCCACAGGGAGGCCTTGGTGGG + Intronic