ID: 1005953510

View in Genome Browser
Species Human (GRCh38)
Location 6:30647821-30647843
Sequence GGTCCCCGATGGTGTCCTAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953510_1005953523 28 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953510_1005953513 -8 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1005953510_1005953524 29 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953510_1005953525 30 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953510 Original CRISPR GGTCCCCGATGGTGTCCTAG AGG (reversed) Exonic
903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG + Intronic
903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG + Intergenic
910763922 1:90761888-90761910 GGCCCCTGAGGGTGCCCTAGGGG - Intergenic
915599586 1:156913907-156913929 GGTCCCGGATGGTGGCATATGGG - Exonic
924844288 1:247749898-247749920 GGTCTCAGATGCTGGCCTAGTGG - Intergenic
1084307896 11:68298703-68298725 GCTCCCTGGTGGAGTCCTAGAGG - Intergenic
1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG + Intronic
1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG + Exonic
1103095676 12:118130623-118130645 GGCCCCTGAGGATGTCCTAGGGG + Intronic
1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG + Intergenic
1127298343 15:57629522-57629544 GGTCTCCCATGGTGGCCAAGAGG - Intronic
1131529419 15:93179292-93179314 GGTCCCTGATGCTTTCCTCGTGG + Intergenic
1132898961 16:2243190-2243212 GGTGCCCGATGGTGTTCTCCAGG + Exonic
1135864706 16:26090626-26090648 GGGCCCCGAGGGTCTCCAAGGGG - Intronic
1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG + Intergenic
1138651278 16:58463115-58463137 GGAGCCCGAGGGTGTCCTTGAGG - Intronic
1140507880 16:75485815-75485837 GGGACCTGATGGTGTCCCAGTGG + Intronic
1142094825 16:88233757-88233779 GGACCCCGATGGGGACGTAGAGG + Intergenic
1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG + Intronic
1147331895 17:39704275-39704297 GGTCCCCGTTGATTTCCTGGGGG - Intronic
1149461026 17:56830548-56830570 GTTCCCCAATGTTGTCCAAGGGG - Intronic
1151397737 17:73835402-73835424 GATCACCGGTGGTTTCCTAGAGG + Intergenic
1162839020 19:13341902-13341924 TGTGCCAGATGTTGTCCTAGGGG - Intronic
1163021372 19:14482640-14482662 GGTCCCTGATGGTGGACCAGAGG - Intronic
1165096247 19:33411414-33411436 GGCCCCCGATGGTTTCCTGTGGG - Intronic
1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG + Intronic
1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG + Exonic
925975679 2:9140272-9140294 GGTCCCGGATGGGGTGCTCGAGG + Intergenic
929111473 2:38408595-38408617 GCTCCCCGATGTTGGCATAGGGG - Intergenic
1172870930 20:38135135-38135157 GGGTCCCGATGGTGACTTAGAGG + Intronic
1175214215 20:57382242-57382264 TGTCCGCGATGGTTTCCTCGTGG + Intergenic
1175996151 20:62813156-62813178 GGTCTCCGATGGGCTCCCAGGGG - Exonic
1176331665 21:5553964-5553986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1176441065 21:6722117-6722139 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176465327 21:7049186-7049208 GGTCCTCGATGCTGGCCCAGCGG - Intronic
1176488888 21:7430964-7430986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1180869296 22:19137401-19137423 AGTCCCCGATGATGACCTGGGGG - Exonic
1182545822 22:31075922-31075944 GGTCCCCCATGGTCTCATATTGG - Intronic
1184471376 22:44698140-44698162 GGTCCCCCTTGGTGACCAAGGGG + Intronic
954733918 3:52689082-52689104 AGCCTCCGATGTTGTCCTAGAGG + Exonic
963889735 3:150620309-150620331 GGTACCCGATGGTGGCATTGTGG + Intronic
967166561 3:186784456-186784478 GGACCCCGATGGTGTCATCGAGG + Exonic
968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG + Intergenic
969695680 4:8732955-8732977 GGGCACCCATGGGGTCCTAGAGG - Intergenic
970399387 4:15703137-15703159 GTTCCCCGATGGCGGCCCAGGGG + Exonic
992174848 5:74139807-74139829 GGTGCCCCATGGTGTCTTGGGGG - Intergenic
997976693 5:138445350-138445372 AGTCCTCGATGGTGTCCAGGAGG - Exonic
998584552 5:143413260-143413282 GGTCACGGAGGGTTTCCTAGAGG + Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1010064974 6:71672019-71672041 TGACCCCGTTGATGTCCTAGAGG + Intergenic
1026482459 7:70790414-70790436 GGTCCCGGATGGGGTCCCAGTGG - Exonic
1027237173 7:76304991-76305013 GGTCCACTGTGGTGTCCTTGGGG - Intergenic
1029864771 7:103615578-103615600 GATCCCTGATGGTCTCCCAGAGG - Intronic
1032491942 7:132330310-132330332 GGTCACTGCTGGTGTCCCAGAGG - Intronic
1034672279 7:152867889-152867911 GGTTCCTGATGGTGGCCTTGTGG + Intergenic
1037948763 8:23005422-23005444 GGTCTCCAAAGGTGTCCCAGAGG - Exonic
1040306453 8:46214414-46214436 AGTCCTCAGTGGTGTCCTAGTGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1046324396 8:112621543-112621565 GGTCACCAATGGTTTCCTTGTGG + Intronic
1049338801 8:142100877-142100899 GATCCCAGAGGGTGTCCTCGGGG + Intergenic
1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG + Intronic
1062261507 9:135665370-135665392 GGTCCCCGAGGGGGTCAGAGGGG - Intronic
1062552566 9:137096580-137096602 GGTCCCCGATAATGTCCTCATGG + Intronic
1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1186726384 X:12363564-12363586 GGTCTCTGATGGTGGCTTAGGGG - Intronic