ID: 1005953510

View in Genome Browser
Species Human (GRCh38)
Location 6:30647821-30647843
Sequence GGTCCCCGATGGTGTCCTAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953510_1005953525 30 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953510_1005953524 29 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953510_1005953523 28 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953510_1005953513 -8 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953510 Original CRISPR GGTCCCCGATGGTGTCCTAG AGG (reversed) Exonic