ID: 1005953512

View in Genome Browser
Species Human (GRCh38)
Location 6:30647832-30647854
Sequence TCGGGTACCTCGGTCCCCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953512_1005953529 30 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953529 6:30647885-30647907 GATCCCCTGGGGGGTTCCTTGGG 0: 1
1: 0
2: 0
3: 15
4: 100
1005953512_1005953527 21 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953527 6:30647876-30647898 CAGTGAGACGATCCCCTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1005953512_1005953528 29 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953528 6:30647884-30647906 CGATCCCCTGGGGGGTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1005953512_1005953525 19 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953512_1005953524 18 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953512_1005953526 20 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953526 6:30647875-30647897 GCAGTGAGACGATCCCCTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 91
1005953512_1005953523 17 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953512 Original CRISPR TCGGGTACCTCGGTCCCCGA TGG (reversed) Exonic