ID: 1005953513

View in Genome Browser
Species Human (GRCh38)
Location 6:30647836-30647858
Sequence CGGGGACCGAGGTACCCGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953501_1005953513 15 Left 1005953501 6:30647798-30647820 CCACGCCCCCAGCAGAGACGGCG 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1005953510_1005953513 -8 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1005953502_1005953513 10 Left 1005953502 6:30647803-30647825 CCCCCAGCAGAGACGGCGCCTCT 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1005953504_1005953513 8 Left 1005953504 6:30647805-30647827 CCCAGCAGAGACGGCGCCTCTAG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1005953503_1005953513 9 Left 1005953503 6:30647804-30647826 CCCCAGCAGAGACGGCGCCTCTA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1005953505_1005953513 7 Left 1005953505 6:30647806-30647828 CCAGCAGAGACGGCGCCTCTAGG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953513 Original CRISPR CGGGGACCGAGGTACCCGAG CGG Exonic
904013836 1:27405662-27405684 CGGGGACCCAGTGAGCCGAGAGG - Exonic
918598561 1:186323761-186323783 CGGTGACTGAGGTGCTCGAGGGG + Exonic
1074169750 10:110920051-110920073 CGGGGGCCCAGGGAGCCGAGAGG - Intronic
1076880401 10:133236877-133236899 CGGGGACCGACGTGACCGGGTGG - Intergenic
1077166239 11:1140697-1140719 TGGGGCCCGAGGTCCCCGACTGG - Intergenic
1086059064 11:82681776-82681798 CTGGGACCCAGGAACCAGAGAGG - Intergenic
1088462275 11:110093661-110093683 CGGGGACGGCGTTGCCCGAGGGG - Intronic
1099425477 12:82518332-82518354 CGGGGACAGAGGAACTCCAGGGG - Intergenic
1109418914 13:62084147-62084169 GGGGGACCAAAGTACCAGAGTGG + Intergenic
1118514304 14:66508854-66508876 CGGGGACCGAGGGGCCGGTGCGG + Intronic
1122823573 14:104359097-104359119 CTGGGGCCGAGGTAGCTGAGTGG + Intergenic
1129264734 15:74387569-74387591 CGGAGACCAAGGTCCCAGAGAGG + Intergenic
1134603998 16:15555707-15555729 TGGGGACCAAGGGACCGGAGAGG - Intronic
1139615322 16:68085247-68085269 CGGAGACCGAGTTACGCGATAGG + Intronic
1143719375 17:8799179-8799201 CGCGGCCCCAGGTACCCGGGAGG + Exonic
1148081270 17:44968604-44968626 CGGGGTCCGAGAGACCCGAGAGG + Intergenic
1151314217 17:73311881-73311903 CGGGGACCGAGGTAGGCGACGGG - Exonic
1152600071 17:81257814-81257836 CGGGGACGAGGGTGCCCGAGGGG + Intronic
1153515023 18:5894925-5894947 CGGGGACTCGGGGACCCGAGGGG + Intronic
1161317996 19:3627196-3627218 CGGGGAGCGAGGTCCCCGAAAGG + Intergenic
932761323 2:74440673-74440695 CTGGGCCCGAGGAACCCGCGTGG - Intronic
937917960 2:127108246-127108268 CAGGGACAGAGGTCCCTGAGAGG + Intergenic
942444003 2:176066550-176066572 CTTGGGCCGAGGTACCCGTGGGG + Intergenic
946328466 2:218996939-218996961 GGGGGTCCGTGGTACCCAAGGGG - Intergenic
1172117880 20:32583047-32583069 CCGGGACCGGGCTCCCCGAGGGG - Intronic
1173978739 20:47206891-47206913 AGGGGACCGAGGTAGCAGGGAGG + Intergenic
1181312464 22:21952684-21952706 ATGGGACCGAGGAACCGGAGGGG - Intronic
962318058 3:134371028-134371050 GGGGGACCGAGATCCCCGTGGGG - Exonic
968967094 4:3774240-3774262 TGGGGAAAGAGATACCCGAGGGG + Intergenic
973531819 4:51843321-51843343 CGGGGACTGCGGGAGCCGAGTGG - Intronic
979785582 4:124712446-124712468 CTGGGGCCGAGGTAACCGGGGGG - Exonic
1005953513 6:30647836-30647858 CGGGGACCGAGGTACCCGAGCGG + Exonic
1006638823 6:35478419-35478441 CTGGGACCCATGTACCCGCGAGG + Exonic
1007591164 6:43021696-43021718 CGGGGCCCGACGTCCCCGCGGGG + Exonic
1018419656 6:163630831-163630853 CGAGGACGGAGGAAACCGAGGGG - Intergenic
1019076776 6:169394280-169394302 CAGGGACAGAGGTACTCTAGGGG + Intergenic
1029535421 7:101154794-101154816 CGGGGATCGAGGGACCCCAGGGG - Intronic
1060530350 9:124344071-124344093 CGGGGACCGAGGACCGCGGGTGG - Intronic
1062064091 9:134516990-134517012 CTGGGGCAGAGATACCCGAGGGG - Intergenic
1185576022 X:1172881-1172903 CAAGGACGGAGGTACCCGCGTGG + Intergenic