ID: 1005953515

View in Genome Browser
Species Human (GRCh38)
Location 6:30647850-30647872
Sequence GGAAGGCGGGCGGACCGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 85}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953515_1005953538 28 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953538 6:30647901-30647923 CCTTGGGAGCGGAGGGACTCGGG 0: 1
1: 0
2: 2
3: 18
4: 193
1005953515_1005953533 17 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953533 6:30647890-30647912 CCTGGGGGGTTCCTTGGGAGCGG 0: 1
1: 0
2: 0
3: 30
4: 277
1005953515_1005953525 1 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953515_1005953528 11 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953528 6:30647884-30647906 CGATCCCCTGGGGGGTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1005953515_1005953535 21 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953535 6:30647894-30647916 GGGGGTTCCTTGGGAGCGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 206
1005953515_1005953534 20 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953534 6:30647893-30647915 GGGGGGTTCCTTGGGAGCGGAGG 0: 1
1: 0
2: 0
3: 19
4: 209
1005953515_1005953529 12 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953529 6:30647885-30647907 GATCCCCTGGGGGGTTCCTTGGG 0: 1
1: 0
2: 0
3: 15
4: 100
1005953515_1005953523 -1 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953515_1005953526 2 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953526 6:30647875-30647897 GCAGTGAGACGATCCCCTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 91
1005953515_1005953536 27 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953536 6:30647900-30647922 TCCTTGGGAGCGGAGGGACTCGG 0: 1
1: 0
2: 1
3: 10
4: 207
1005953515_1005953524 0 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953515_1005953527 3 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953527 6:30647876-30647898 CAGTGAGACGATCCCCTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953515 Original CRISPR GGAAGGCGGGCGGACCGCTC GGG (reversed) Intronic