ID: 1005953523

View in Genome Browser
Species Human (GRCh38)
Location 6:30647872-30647894
Sequence CCTGCAGTGAGACGATCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953514_1005953523 7 Left 1005953514 6:30647842-30647864 CCGAGGTACCCGAGCGGTCCGCC 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953515_1005953523 -1 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953510_1005953523 28 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953512_1005953523 17 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953516_1005953523 -2 Left 1005953516 6:30647851-30647873 CCGAGCGGTCCGCCCGCCTTCCC 0: 1
1: 0
2: 0
3: 12
4: 321
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953523 Original CRISPR CCTGCAGTGAGACGATCCCC TGG Intronic
901627145 1:10630800-10630822 GCTGCGCTGAGACGAACCCCCGG - Intergenic
902602864 1:17551878-17551900 CCTCCAGTGAGCCGCTCCCTGGG - Intronic
902869856 1:19307410-19307432 CCTGCAGGGAGAGGGACCCCGGG + Exonic
903009197 1:20318442-20318464 CCTGCAGTGTGACCATGGCCAGG - Intronic
905124415 1:35707321-35707343 CCTGAAGTGAGGCGAGCCTCAGG - Intergenic
911459263 1:98168930-98168952 CCTCCAGTGAGACCACACCCCGG + Intergenic
915965804 1:160307221-160307243 CCTGAAGGGAAACGATCCTCAGG - Exonic
918067893 1:181113707-181113729 GCTGCAGTGAGAGGAGCCTCAGG - Intergenic
918077776 1:181183445-181183467 CCAGCAGTGAGACGCACTCCTGG - Intergenic
919746770 1:201013904-201013926 CCTGGAGTGAGATGACCTCCAGG - Intronic
921561142 1:216659689-216659711 TCTTCAGTGAGATGATCCCAGGG + Intronic
1063526336 10:6789914-6789936 TCTGCAGTGTGACGATGCCTTGG + Intergenic
1063846119 10:10128470-10128492 CCTGCAGTATGACAAACCCCAGG - Intergenic
1066219948 10:33326577-33326599 CCTGCAGACAGACGCTCCACTGG + Intronic
1070222067 10:74458229-74458251 CCTGAAGTGAGAGGATCACTTGG - Intronic
1072665276 10:97388273-97388295 GCTGCAGTGAGACTCTCCTCAGG - Exonic
1073513619 10:104058104-104058126 CCTGCAGTGACAGGATCCAGTGG - Intronic
1074307851 10:112295773-112295795 CCTGCAGAGAGATGATTCCAGGG - Intronic
1076132292 10:128021694-128021716 CCTGCTGTGAGACTGTGCCCCGG + Intronic
1077159714 11:1107258-1107280 TCTGCAGTAAGGCCATCCCCTGG + Intergenic
1083804606 11:65066458-65066480 CCTGCAGTGACCCAAACCCCCGG - Intronic
1084358003 11:68652287-68652309 CCTCCAGGGAGATGGTCCCCAGG + Intergenic
1094171527 12:27497678-27497700 AGTGCAGTGACACGATCTCCAGG - Intronic
1095834967 12:46627940-46627962 CCTGCAGTGAGAGGGTGCACTGG + Intergenic
1096362914 12:51003450-51003472 CTTGCAGTGAGGCGATTCCAGGG - Intronic
1101556929 12:105818869-105818891 CCTGCAGTTATACCATCCTCTGG - Intergenic
1110567329 13:76969468-76969490 CCTGCACTGAGAATATCCCCTGG - Intergenic
1117003181 14:51392731-51392753 CATCCAGTGAGATGTTCCCCTGG + Intergenic
1117404246 14:55386520-55386542 CCTGCTGTGAGATTATCCCTGGG - Intronic
1118806204 14:69239078-69239100 CATTCAGTGAGCCGATACCCTGG - Intronic
1127266203 15:57364434-57364456 CCTGCAGTCAGCCCATCACCTGG - Intergenic
1129480344 15:75820144-75820166 GCTCCAGTGAGACGATGCCCTGG + Intergenic
1132390008 15:101431681-101431703 CCTGCTGGGAGGCGATGCCCTGG - Intronic
1132814346 16:1818664-1818686 CCTACAGTGAGGCCGTCCCCCGG + Intronic
1140046378 16:71442572-71442594 CCTGCAGAGAGAGGGCCCCCAGG + Intergenic
1142089215 16:88201064-88201086 CCTGCGGGGTGAGGATCCCCGGG - Intergenic
1143097572 17:4486543-4486565 CCTGGAGAGAGACGAGACCCGGG + Exonic
1146953604 17:36923087-36923109 CCTGGGGTGTGACGTTCCCCAGG + Intergenic
1148496408 17:48055647-48055669 CAGGCAGTCAGATGATCCCCAGG - Intronic
1148774829 17:50089424-50089446 CCTCCTGTGGGAAGATCCCCAGG - Exonic
1151963524 17:77419636-77419658 CCTGCAGTTAGACCAGCACCGGG - Intronic
1152568541 17:81111191-81111213 CCAGCAGTGAGAGGAGCCCCGGG - Intronic
1152919186 17:83057294-83057316 TCTGCAGTGAGAAGAGCCTCAGG - Intergenic
1154235957 18:12605951-12605973 CCTGCAGTGGGAAGATGCCTAGG - Intronic
1157288377 18:46392854-46392876 CCTTCAGTGAGATGACCTCCTGG + Intronic
1157565117 18:48674632-48674654 ACTGCAGTGAGACTCACCCCTGG - Intronic
1162379458 19:10323037-10323059 GCTGCAGTGACAGGAGCCCCAGG - Intronic
1163441744 19:17325371-17325393 CCTGCAGAGACACGAGCGCCAGG - Exonic
1164176951 19:22783790-22783812 CCTGCACTGTGACTATGCCCTGG - Intronic
1164421678 19:28099084-28099106 TCTGCAGTGGCACCATCCCCAGG - Intergenic
1165344109 19:35232862-35232884 CCTGAAGTGTGACCATCCCATGG - Intergenic
933185739 2:79277496-79277518 CCAGCAGTGAGAGGATCCTTAGG - Intronic
933354474 2:81195870-81195892 CCGGCAGTGAGAAGGACCCCAGG + Intergenic
936018940 2:108980255-108980277 TCTGCAGTGAGAGAATCCCAGGG + Intronic
938689821 2:133777221-133777243 CCTGGACTGTGACAATCCCCAGG + Intergenic
1169630565 20:7626106-7626128 ACTGCAGTGAGACGATCCCCAGG + Intergenic
1174058646 20:47816998-47817020 GCTGCAGTGAGAAGACCCCGTGG - Intergenic
1176156803 20:63626394-63626416 CCCGCAGGGACGCGATCCCCAGG - Intronic
1176156820 20:63626438-63626460 CCCGCAGGGACGCGATCCCCAGG - Intronic
1177241068 21:18458011-18458033 ACTGCATTGAGACGAAGCCCAGG + Intronic
1180997220 22:19971546-19971568 CCTGCTGTGTGCCAATCCCCTGG - Intronic
1184703085 22:46190648-46190670 CCTGAGGTGAGAGGATCACCTGG + Intronic
949509757 3:4757793-4757815 CTTGCAGAGAGAGGGTCCCCAGG + Intronic
949540195 3:5026616-5026638 CCTGCAGGCAGGCGGTCCCCGGG + Intergenic
950306064 3:11915917-11915939 CCTGCAAGGAAACGAGCCCCAGG + Intergenic
950423472 3:12912145-12912167 CCTGCAGGGAGACTGGCCCCTGG + Intronic
950576712 3:13836577-13836599 CCTGCAGTGGGAGGTTCCACTGG - Intronic
952409049 3:33031104-33031126 CCTGCTGGGAGATTATCCCCAGG + Intronic
953032610 3:39188221-39188243 CCTACAGCGAGTGGATCCCCAGG - Exonic
954756733 3:52844417-52844439 CCTTCAGTGTGCCGATGCCCTGG - Intronic
965826514 3:172736389-172736411 GCTGCAGTGAGAGGATCTACTGG + Intergenic
966410750 3:179643711-179643733 GCTTCAGTGAGACCATCCCTGGG - Intergenic
970094659 4:12449236-12449258 GCTGCAGTGAGAGGATCACTTGG + Intergenic
983122186 4:163900030-163900052 CCTTCAGTGATCCCATCCCCAGG + Intronic
984426707 4:179596886-179596908 CCTGCTGTGGGATGATACCCTGG + Intergenic
985125352 4:186688460-186688482 CCTGCAGTGAGATGGCCCCTGGG + Intronic
986755038 5:10827476-10827498 CTTGCAGGGAGATGATGCCCTGG - Intergenic
992632934 5:78699470-78699492 CCTGAACTGAGATGATACCCAGG + Intronic
992967686 5:82019991-82020013 CCTGCAGGGAGACCAACCCCTGG - Intronic
993533083 5:89047670-89047692 CATGCAGTGAGACTCTTCCCAGG + Intergenic
994578002 5:101605929-101605951 CCTGCAGTGAGTTGGTCACCAGG - Intergenic
997474240 5:134133528-134133550 CCTGGAGTGGGACGTTCCACTGG + Intronic
1001939570 5:175731012-175731034 CCTGCAATCAGGCCATCCCCTGG + Intergenic
1003180649 6:3788618-3788640 CCTGCAGTGTGGTGCTCCCCAGG + Intergenic
1004151508 6:13124299-13124321 CCTTCAGTGACATGAGCCCCAGG - Intronic
1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG + Intronic
1008591102 6:52994824-52994846 CCTACAGGGAGATGAGCCCCCGG + Intronic
1014817071 6:125947727-125947749 CCTGCTGAGAGAAGATGCCCTGG + Intergenic
1018287594 6:162257528-162257550 TCTGAAGTGAGACGGTCCCTGGG + Intronic
1018899012 6:168041978-168042000 CCTGCAGTGCCACCCTCCCCAGG + Exonic
1030092221 7:105867629-105867651 CCTGTACTGTGACTATCCCCTGG - Intronic
1030278428 7:107744227-107744249 CCTGCTGTGCGACCAGCCCCAGG - Intronic
1033259624 7:139831466-139831488 CCTCCAGTGAGAGGATTCACAGG + Intronic
1036698958 8:10998648-10998670 CCTGGAGAGAGCCAATCCCCTGG - Intronic
1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG + Exonic
1041550667 8:59097142-59097164 CCTGAAGTGACACCATCCCCGGG + Intronic
1043968865 8:86508544-86508566 CCCGCAGGGAGACGAGACCCCGG + Exonic
1049029929 8:140027144-140027166 CCTGCACTCAGAAGATACCCAGG - Intronic
1049178368 8:141207652-141207674 CGTGGACTGAGACCATCCCCTGG - Intronic
1057715086 9:97486818-97486840 CCTTCAGTGAAGGGATCCCCTGG + Intronic
1057809079 9:98243895-98243917 CCTGCAGGGAGATGGGCCCCGGG - Intronic
1058795795 9:108497174-108497196 CTTGAAGTGAGACGCTCCCCGGG - Intergenic
1060342911 9:122792730-122792752 CCTGCAGAGAGAGGCTTCCCAGG - Intergenic
1062565819 9:137163515-137163537 CCTGCAGTGAGGCGGGGCCCAGG - Intronic
1186189775 X:7057106-7057128 CCTGGACAGAGACCATCCCCAGG - Intronic
1201240928 Y:11955595-11955617 ACTGAAGGGAGACGAGCCCCCGG + Intergenic