ID: 1005953523

View in Genome Browser
Species Human (GRCh38)
Location 6:30647872-30647894
Sequence CCTGCAGTGAGACGATCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953510_1005953523 28 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953515_1005953523 -1 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953516_1005953523 -2 Left 1005953516 6:30647851-30647873 CCGAGCGGTCCGCCCGCCTTCCC 0: 1
1: 0
2: 0
3: 12
4: 321
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953512_1005953523 17 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98
1005953514_1005953523 7 Left 1005953514 6:30647842-30647864 CCGAGGTACCCGAGCGGTCCGCC 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1005953523 6:30647872-30647894 CCTGCAGTGAGACGATCCCCTGG 0: 1
1: 1
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953523 Original CRISPR CCTGCAGTGAGACGATCCCC TGG Intronic