ID: 1005953524

View in Genome Browser
Species Human (GRCh38)
Location 6:30647873-30647895
Sequence CTGCAGTGAGACGATCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953512_1005953524 18 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953517_1005953524 -10 Left 1005953517 6:30647860-30647882 CCGCCCGCCTTCCCTGCAGTGAG 0: 1
1: 0
2: 2
3: 27
4: 265
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953516_1005953524 -1 Left 1005953516 6:30647851-30647873 CCGAGCGGTCCGCCCGCCTTCCC 0: 1
1: 0
2: 0
3: 12
4: 321
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953515_1005953524 0 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953514_1005953524 8 Left 1005953514 6:30647842-30647864 CCGAGGTACCCGAGCGGTCCGCC 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132
1005953510_1005953524 29 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953524 Original CRISPR CTGCAGTGAGACGATCCCCT GGG Intronic
901627144 1:10630799-10630821 CTGCGCTGAGACGAACCCCCGGG - Intergenic
903102509 1:21044142-21044164 CTGCACTGAGTTGGTCCCCTTGG + Intronic
904628126 1:31820174-31820196 GTGCAGTGATATGATCACCTGGG + Intergenic
912454456 1:109788410-109788432 CTGCAGAGAGACGATCACTGTGG + Intergenic
913352261 1:117874863-117874885 CTGCACTGTGTCCATCCCCTAGG + Intronic
918077775 1:181183444-181183466 CAGCAGTGAGACGCACTCCTGGG - Intergenic
920024960 1:202987631-202987653 CTGCATTGAGGCAATCCCCACGG + Intergenic
921352293 1:214248666-214248688 CTGGAGGGAGATGATCCCCCTGG + Intergenic
1063104693 10:2982831-2982853 CTGCAGGGAGAACATCCACTTGG + Intergenic
1063672013 10:8106560-8106582 CTGCTGTGAGGGGATCCTCTAGG + Intergenic
1065047758 10:21759207-21759229 CAGCGGTCAGAGGATCCCCTTGG + Exonic
1068391633 10:56405300-56405322 CTGAAGTGGGAGGATCCCTTGGG + Intergenic
1070222066 10:74458228-74458250 CTGAAGTGAGAGGATCACTTGGG - Intronic
1070948437 10:80411845-80411867 CTGAAGAGGGACGATTCCCTGGG + Intronic
1071437694 10:85662434-85662456 CTGCAGTGAAAGGAGCCGCTGGG + Intronic
1071770419 10:88722981-88723003 CTGAGGTGAGAGGATCACCTGGG - Intergenic
1072240081 10:93487892-93487914 CTGCAGTGGGAGGATCACCTAGG + Intergenic
1072665275 10:97388272-97388294 CTGCAGTGAGACTCTCCTCAGGG - Exonic
1072959405 10:99915614-99915636 CTGAAGTGGGAGGATCACCTGGG + Intronic
1073268840 10:102244761-102244783 GAGCAGAGAGACGAACCCCTGGG - Intergenic
1073513618 10:104058103-104058125 CTGCAGTGACAGGATCCAGTGGG - Intronic
1074014833 10:109523837-109523859 CTGAAGTGGGATGATCGCCTGGG - Intergenic
1075901609 10:126047366-126047388 CTGGAATGTGACCATCCCCTTGG - Intronic
1075937248 10:126352883-126352905 CTGCACTGAAACCATTCCCTGGG - Intronic
1077159715 11:1107259-1107281 CTGCAGTAAGGCCATCCCCTGGG + Intergenic
1079083571 11:17430146-17430168 CTGGAGTGAGAAGATGTCCTTGG - Intronic
1083445663 11:62706540-62706562 CTGCAGTCAGCGCATCCCCTGGG - Intronic
1083859041 11:65409973-65409995 CTGAAGTGGGAGGATCACCTAGG + Intronic
1085310130 11:75511314-75511336 ATGCAGTGAGAAGATCTCATGGG - Intronic
1090835910 11:130453491-130453513 CTGCAGTGAGTTGATGGCCTGGG - Intronic
1092210392 12:6642419-6642441 CTGCAGATAGATGATCACCTAGG - Intronic
1094597701 12:31880299-31880321 CTTCAGTGAGACGATGGGCTGGG - Intergenic
1095149585 12:38776541-38776563 CTCCAGTGATCCGCTCCCCTCGG + Intronic
1100823221 12:98451257-98451279 CTGCGGTGGGAGGATCACCTGGG + Intergenic
1102243464 12:111340143-111340165 GTGCAGTGGCACGATCCTCTTGG - Intronic
1102709851 12:114916309-114916331 CTGCAGTGAGGCTATCTCCAAGG + Intergenic
1103460485 12:121100581-121100603 CTGAAGTGAGAGGATCGCTTAGG - Intergenic
1105596222 13:21841784-21841806 GTGCAGTCAGAGGGTCCCCTGGG - Intergenic
1106805499 13:33302513-33302535 CTGAAGTGGGAAGATCACCTGGG - Intronic
1107763335 13:43705763-43705785 CTGCATTCATACTATCCCCTTGG - Intronic
1108182638 13:47855887-47855909 CTGAAGTGGGAGGATCACCTGGG - Intergenic
1110797467 13:79657000-79657022 CTGAGGTGAGAGGATCACCTGGG - Intergenic
1111433197 13:88171545-88171567 TTGCAATGAGACAATCCCATTGG - Intergenic
1113183492 13:107659195-107659217 CTGAAGTGTCACGTTCCCCTGGG + Intronic
1115632577 14:35260108-35260130 CTGAAGTGGGAGGATCCCTTGGG - Intronic
1115635313 14:35285245-35285267 CTGAAGTGGGAGGATCGCCTGGG + Intronic
1115686568 14:35802778-35802800 CTGAGGTGAGAGGATCACCTGGG - Intronic
1115998762 14:39220310-39220332 CTGAAGTGAGAGGATCACTTGGG + Intergenic
1117003182 14:51392732-51392754 ATCCAGTGAGATGTTCCCCTGGG + Intergenic
1118192201 14:63591002-63591024 CTGAAGTGGGAAGATCCCCCAGG + Intergenic
1119224982 14:72938162-72938184 CTGCATTGGGACGAGCCCCCAGG - Intronic
1119729292 14:76940768-76940790 CTGAGGTGAGAGGATCACCTGGG + Intergenic
1121105657 14:91277963-91277985 CAGCAGTGAGATGGTCACCTTGG - Exonic
1121505208 14:94472017-94472039 CTGCACAGAGACGATCTACTGGG + Intronic
1122660745 14:103293379-103293401 CTGAGGTGAGAGGATCACCTGGG + Intergenic
1122835243 14:104427578-104427600 CTCCAGGGAGACGATGGCCTCGG - Intergenic
1122911356 14:104829457-104829479 CTACAGTGGGAGGATCCCTTGGG + Intergenic
1128167882 15:65483289-65483311 CTGAAGTGAGAGGATCACTTGGG + Intronic
1129480345 15:75820145-75820167 CTCCAGTGAGACGATGCCCTGGG + Intergenic
1132390007 15:101431680-101431702 CTGCTGGGAGGCGATGCCCTGGG - Intronic
1133105282 16:3503687-3503709 CTGAGGTGGGACGATCACCTGGG - Intronic
1133293775 16:4739958-4739980 CTGAAGTGGGAGGATCGCCTGGG + Intronic
1133898799 16:9953807-9953829 GTGCAGTGAGATGTTCACCTGGG + Intronic
1135289340 16:21221897-21221919 ATGCTGAGCGACGATCCCCTGGG - Intergenic
1136508734 16:30723002-30723024 TTGTAGTGAGACAAGCCCCTCGG + Exonic
1140118918 16:72066655-72066677 CTGAATTTAGAAGATCCCCTTGG + Intronic
1140843143 16:78860912-78860934 CTGAAGTGGGAGGATCACCTGGG - Intronic
1141639289 16:85332249-85332271 CTGCAGTGCCACCAACCCCTGGG + Intergenic
1141684183 16:85561031-85561053 CTGAGGTGAGAGGATCACCTGGG + Intergenic
1143621697 17:8084589-8084611 CCCCAGTGAGACCCTCCCCTTGG + Intronic
1146780324 17:35665224-35665246 CTGCGGTGGGAGGATCACCTGGG - Intronic
1151772080 17:76170325-76170347 CTGAAGTGGGAGGATCACCTGGG - Intronic
1152015874 17:77749846-77749868 CTGCTCTGGGACAATCCCCTGGG - Intergenic
1152925901 17:83087636-83087658 CAGCAGTGACGCCATCCCCTGGG + Intronic
1153902726 18:9632830-9632852 CTGAGGTGAGAGGATCACCTGGG - Intergenic
1158106580 18:53891460-53891482 TAGAAGTGAGAGGATCCCCTTGG + Intergenic
1160233337 18:77065954-77065976 CTGAAGTGAGAGGATCACTTGGG - Intronic
1162111729 19:8403338-8403360 CTGCAGGGAGGGGTTCCCCTCGG + Intronic
1163477721 19:17536636-17536658 CTGAAGTGGGAGGATCCCTTGGG - Intronic
1164582529 19:29443210-29443232 CTGCAGTGAGAGGCTCCCAGAGG + Intergenic
1167859096 19:52268988-52269010 CTCCAGTGATACGACCGCCTCGG + Intergenic
1168335927 19:55597789-55597811 CTGCAGTGAAACGGGACCCTGGG + Exonic
934655166 2:96113493-96113515 CTCCAGTGGGAGGCTCCCCTAGG + Exonic
935400934 2:102659340-102659362 CTGAAGTGAGAGGATCGCTTGGG + Intronic
936448924 2:112618881-112618903 CTGAGGTGAGAGGATCACCTGGG - Intergenic
940857484 2:158740794-158740816 CTGCAGTGACTAAATCCCCTTGG + Intergenic
948426192 2:237887830-237887852 CTGAAGTGGGAGGATCGCCTCGG + Intronic
1181256156 22:21564132-21564154 CTGAAGTGAGAGGATCACTTGGG - Intronic
1184703086 22:46190649-46190671 CTGAGGTGAGAGGATCACCTGGG + Intronic
950265470 3:11569780-11569802 CTGAAGTGGGAGGATCACCTGGG + Intronic
950423473 3:12912146-12912168 CTGCAGGGAGACTGGCCCCTGGG + Intronic
965481068 3:169220229-169220251 CTGAGGTGAGAGGATCACCTGGG + Intronic
965826515 3:172736390-172736412 CTGCAGTGAGAGGATCTACTGGG + Intergenic
970510096 4:16773415-16773437 CTGCAATTAGACAATCCCATTGG + Intronic
973299020 4:48559459-48559481 CTGGGGTGGGAGGATCCCCTGGG + Intronic
976611788 4:87038050-87038072 ATGCATTGAGATAATCCCCTGGG + Intronic
982727884 4:158924741-158924763 CTGAGGTGAGAGGATCCCTTGGG - Intronic
992791921 5:80221225-80221247 CTGATGTCAGATGATCCCCTGGG - Intronic
994617901 5:102129236-102129258 CTACAGTGAGAGGATACCCCTGG - Intergenic
996418486 5:123236039-123236061 CTGCCGTGTGGAGATCCCCTGGG + Intergenic
997474241 5:134133529-134133551 CTGGAGTGGGACGTTCCACTGGG + Intronic
999306849 5:150525186-150525208 CTGCAGTGAGGCCAGCCTCTCGG + Intronic
1000170814 5:158701559-158701581 CAGCAGTGAGTGAATCCCCTGGG + Intronic
1005953524 6:30647873-30647895 CTGCAGTGAGACGATCCCCTGGG + Intronic
1008565067 6:52759815-52759837 CTGAAGTGAGTGGATCACCTGGG - Intronic
1011593787 6:88996929-88996951 CTGAAGTGGGAGGATCCCTTGGG - Intergenic
1016775770 6:147903475-147903497 CTGCTGTTAGACGATGCCATTGG - Intergenic
1017942045 6:159061551-159061573 GTGCAGTGATACCAGCCCCTTGG + Intergenic
1020121580 7:5507030-5507052 CTGCTCTGAGAGGCTCCCCTTGG - Intronic
1025036331 7:55594499-55594521 CTGCAGTGAGGTGAGCCACTGGG + Intergenic
1026885790 7:73943621-73943643 CTGAAGTGGGAGGGTCCCCTGGG + Intergenic
1027035892 7:74924981-74925003 CTGCAGTGAGCCTATGCCCCAGG - Intergenic
1027127130 7:75564692-75564714 CTGAGGTGAGAGGATCCCTTGGG - Intronic
1027605526 7:80294001-80294023 CTGCAGTGGGAGGATCACTTGGG - Intergenic
1027608124 7:80325351-80325373 CTGAAGTGAGAGGGTCACCTGGG + Intergenic
1029475081 7:100778507-100778529 CTGAGGTGGGACGATCCCTTGGG + Intronic
1032340576 7:131069030-131069052 CTGAAGTGAGAGGATCGCTTGGG + Intergenic
1034746368 7:153527228-153527250 CTGCAGTGAGAAGAGGCGCTGGG - Intergenic
1035841859 8:2821640-2821662 CTGAGGTGAGAGGATCACCTGGG - Intergenic
1036698957 8:10998647-10998669 CTGGAGAGAGCCAATCCCCTGGG - Intronic
1042509374 8:69595268-69595290 GTGGAGTGAGAAGATCACCTGGG - Intronic
1042874691 8:73430225-73430247 CTGCAGTGAGAAGAGGCACTGGG + Intronic
1045346499 8:101298493-101298515 CTGCAGTGGGAGGATCACTTGGG - Intergenic
1046456737 8:114475085-114475107 CTGCTGTGAGAAGCTCCACTGGG + Intergenic
1050407270 9:5322704-5322726 CTCCAGTGAGAGGATCCCAAAGG - Intergenic
1050414268 9:5398653-5398675 CTCCAGTGAGAGGATCCCAAAGG - Intronic
1052229340 9:26129423-26129445 CTGCATTGAGTCAATCCCCAAGG - Intergenic
1053753730 9:41280955-41280977 CTGCAGTGAGAACCGCCCCTTGG - Intergenic
1054259253 9:62845315-62845337 CTGCAGTGAGAACCGCCCCTTGG - Intergenic
1054332526 9:63774722-63774744 CTGCAGTGAGAACCGCCCCTTGG + Intergenic
1056022783 9:82458102-82458124 CTTCAGAGAGAGAATCCCCTGGG - Intergenic
1186203756 X:7180250-7180272 CTGCAACTAGACGATCCCATCGG + Intergenic
1189108327 X:38259806-38259828 CTGAAGTGAGAGGATCGCTTGGG - Intronic
1193375515 X:80755541-80755563 ATACAGTGAGATGATCCCTTAGG + Intronic
1197266458 X:124379081-124379103 CTGCAGTAAAACAAGCCCCTTGG - Exonic
1199820043 X:151435738-151435760 CTGAAGTGGGAGGATCACCTGGG + Intergenic
1201240929 Y:11955596-11955618 CTGAAGGGAGACGAGCCCCCGGG + Intergenic