ID: 1005953525

View in Genome Browser
Species Human (GRCh38)
Location 6:30647874-30647896
Sequence TGCAGTGAGACGATCCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 315}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953517_1005953525 -9 Left 1005953517 6:30647860-30647882 CCGCCCGCCTTCCCTGCAGTGAG 0: 1
1: 0
2: 2
3: 27
4: 265
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953515_1005953525 1 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953510_1005953525 30 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953512_1005953525 19 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953516_1005953525 0 Left 1005953516 6:30647851-30647873 CCGAGCGGTCCGCCCGCCTTCCC 0: 1
1: 0
2: 0
3: 12
4: 321
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953514_1005953525 9 Left 1005953514 6:30647842-30647864 CCGAGGTACCCGAGCGGTCCGCC 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953525 Original CRISPR TGCAGTGAGACGATCCCCTG GGG Intronic