ID: 1005953525

View in Genome Browser
Species Human (GRCh38)
Location 6:30647874-30647896
Sequence TGCAGTGAGACGATCCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 315}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005953515_1005953525 1 Left 1005953515 6:30647850-30647872 CCCGAGCGGTCCGCCCGCCTTCC 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953514_1005953525 9 Left 1005953514 6:30647842-30647864 CCGAGGTACCCGAGCGGTCCGCC 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953517_1005953525 -9 Left 1005953517 6:30647860-30647882 CCGCCCGCCTTCCCTGCAGTGAG 0: 1
1: 0
2: 2
3: 27
4: 265
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953510_1005953525 30 Left 1005953510 6:30647821-30647843 CCTCTAGGACACCATCGGGGACC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953516_1005953525 0 Left 1005953516 6:30647851-30647873 CCGAGCGGTCCGCCCGCCTTCCC 0: 1
1: 0
2: 0
3: 12
4: 321
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315
1005953512_1005953525 19 Left 1005953512 6:30647832-30647854 CCATCGGGGACCGAGGTACCCGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005953525 Original CRISPR TGCAGTGAGACGATCCCCTG GGG Intronic
900441457 1:2657621-2657643 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900441862 1:2659708-2659730 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900442755 1:2664324-2664346 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900443648 1:2668940-2668962 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900444243 1:2672031-2672053 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900444650 1:2674118-2674140 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900445148 1:2676687-2676709 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900445857 1:2680421-2680443 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900446943 1:2685960-2685982 TGCAGTCAGATGCTCGCCTGTGG - Intronic
900447348 1:2688007-2688029 TGCAGTCAGATGCTCGCCTGGGG - Intronic
900447870 1:2690540-2690562 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900448435 1:2693386-2693408 TGCAGTCAGATGCTCGCCTGTGG - Intronic
900448562 1:2694028-2694050 TGCTGTGAGATGCTCGCCTGGGG - Intronic
900448976 1:2696116-2696138 TGCAGTCAGATGCTCGCCTGGGG - Intronic
900449001 1:2696237-2696259 TGCAGTCAGATGCTCTCCTGGGG - Intronic
900450721 1:2748320-2748342 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900451908 1:2754338-2754360 TGCAGTCAGATGCTCGCCTGTGG - Intronic
900452034 1:2754980-2755002 TGCTGTGAGATGCTCGCCTGGGG - Intronic
900452443 1:2757067-2757089 TGCAGTCAGATGCTCGCCTGGGG - Intronic
900452468 1:2757188-2757210 TGCAGTCAGATGCTCTCCTGGGG - Intronic
900453773 1:2763737-2763759 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900454486 1:2767322-2767344 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900455218 1:2770999-2771021 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900455964 1:2774744-2774766 TGCGGTCAGATGCTCCCCTGGGG - Intronic
900668329 1:3831639-3831661 TGCAGTGATACGGTCACCAGTGG + Intronic
901722416 1:11210244-11210266 TGAAGTGGGAGGATCACCTGAGG - Intronic
902290937 1:15434298-15434320 TGAGGTGAGAGGATCCCTTGAGG - Intergenic
903131292 1:21280954-21280976 TGAAGTGGGAGGATCACCTGAGG + Intronic
903743384 1:25571320-25571342 TGCAATGAGACATACCCCTGTGG - Intergenic
903899894 1:26636447-26636469 TGAGGTGAGAGGATCACCTGAGG + Intergenic
905317861 1:37094982-37095004 TGCAGAGACAGGATCCCCTGAGG - Intergenic
906047271 1:42841413-42841435 TGCAGTGGGAGGTTCACCTGAGG + Intronic
906347571 1:45028521-45028543 TGAGGTGAGTCGATCACCTGAGG + Intronic
907032095 1:51182411-51182433 TGAAGTGAGCGGATCACCTGAGG + Intergenic
907501668 1:54885975-54885997 TGCGGAGAGACGTTCCCATGAGG - Intronic
908731021 1:67226471-67226493 TGCTGAGAGAAGTTCCCCTGGGG - Intronic
908951544 1:69568125-69568147 TGCAGGGCGAGGATCCCCAGGGG - Intergenic
909010207 1:70325997-70326019 TGAAGTGGGCCGATCACCTGAGG + Intronic
909786835 1:79623857-79623879 TGCAGTGCTGCGATCCCCTCTGG + Intergenic
909986656 1:82169511-82169533 TGAAGTGGGAGGATCACCTGAGG - Intergenic
911400298 1:97366510-97366532 CTCAGTGGGATGATCCCCTGAGG - Intronic
914373637 1:147052449-147052471 TGCTGTGAGGCGACTCCCTGAGG - Intergenic
915464358 1:156087783-156087805 TGAAGTGGGAGGATCACCTGAGG - Intronic
920524367 1:206655852-206655874 TGCAGTGGGAGGATCACCTGAGG - Intronic
922532485 1:226355054-226355076 TGAAGTGGGAGGATCACCTGAGG - Intergenic
923002689 1:230020647-230020669 AGCAGGGAGAAGATGCCCTGTGG + Intergenic
923185301 1:231567075-231567097 TGAAGTGAGAGGATCACTTGAGG - Intronic
923484641 1:234417041-234417063 TGCAGTGTGAGGATCAGCTGTGG + Intronic
924409878 1:243793539-243793561 TGAAGTGAGAGGATCTCTTGAGG + Intronic
1063134953 10:3208412-3208434 TGAAGTGGGAGGATCCCTTGAGG - Intergenic
1064025315 10:11844087-11844109 TGCAGTGGGAGGATCACTTGAGG - Intronic
1064180740 10:13112339-13112361 TGAAGTGGGAGGATCCCTTGAGG - Intronic
1064278653 10:13931065-13931087 TGAAGTGAGAGGATCGCTTGAGG - Intronic
1066215735 10:33285595-33285617 TGAGGTGAGAGGATCACCTGAGG + Intronic
1069427575 10:68302608-68302630 TGAGGTGAGAGGATCACCTGAGG + Intronic
1069432060 10:68346356-68346378 TGAGGTGAGAGGATCGCCTGAGG + Intronic
1070108376 10:73458835-73458857 TGAAGTGGGACAATCACCTGAGG + Intronic
1070900785 10:80027178-80027200 TGGAGTGAGAAGATCACTTGAGG + Intergenic
1070901492 10:80033695-80033717 TGGAGTGAGAAGATCACTTGAGG + Intergenic
1070902522 10:80042944-80042966 TGGAGTGAGAAGATCACTTGAGG + Intergenic
1070903654 10:80052790-80052812 TGCGGTGAGCGGATCACCTGAGG - Intergenic
1072686154 10:97538257-97538279 TGAGGTGAGAGGATCCCTTGAGG + Intronic
1072777735 10:98216810-98216832 TGAGGTGAGACGATCACTTGAGG - Intronic
1073513617 10:104058102-104058124 TGCAGTGACAGGATCCAGTGGGG - Intronic
1076987280 11:247597-247619 TGAAGTGAGTGGATCACCTGAGG + Intronic
1077159716 11:1107260-1107282 TGCAGTAAGGCCATCCCCTGGGG + Intergenic
1080371193 11:31646099-31646121 TGGAGTAGGACCATCCCCTGTGG + Intronic
1080589740 11:33711452-33711474 TGAAGTGAGAGGATTGCCTGCGG + Intronic
1083445662 11:62706539-62706561 TGCAGTCAGCGCATCCCCTGGGG - Intronic
1083688826 11:64393948-64393970 TGAAGCGAGAGGATCACCTGAGG - Intergenic
1085592500 11:77777357-77777379 TGCAGCGGGTGGATCCCCTGAGG + Intronic
1087876351 11:103362795-103362817 CGAAGTGGGAGGATCCCCTGAGG + Intronic
1088120751 11:106365990-106366012 TGAAGTGGGAGGATCACCTGAGG + Intergenic
1088282112 11:108145810-108145832 TGAAGTGAGCAGATCACCTGAGG + Intronic
1088869141 11:113876383-113876405 TGCAGTGAGCCGAGACCGTGCGG - Intergenic
1089030322 11:115320158-115320180 TGAGGTGAGAGGATCGCCTGAGG - Intronic
1090000757 11:122955351-122955373 TGAAGTGAGCAGATCACCTGAGG - Intronic
1090018600 11:123107461-123107483 TGAAGTGGGAGGATCACCTGAGG - Intronic
1090019104 11:123111361-123111383 TGCGGTGGGCCGATCACCTGAGG - Intronic
1090991073 11:131817508-131817530 TGCTGGGAGAGGAGCCCCTGAGG - Intronic
1093535723 12:20220254-20220276 TGAAGTGAGACGTATCCCTGAGG + Intergenic
1094597700 12:31880298-31880320 TTCAGTGAGACGATGGGCTGGGG - Intergenic
1095435606 12:42184540-42184562 TGCGGTGAGTCAATCACCTGAGG - Intronic
1097424764 12:59429538-59429560 TGCAGTTACATGATTCCCTGTGG + Intergenic
1100347948 12:93750990-93751012 TTCAGTGAGAGCATTCCCTGAGG - Intronic
1100964387 12:99996922-99996944 TGAAGTGAGAGGATCACTTGAGG + Intergenic
1101002332 12:100369041-100369063 GGCAGGGAGAGGATCACCTGAGG + Intronic
1102014684 12:109640050-109640072 TGCAGTGGGAGGATCACTTGAGG - Intergenic
1102174239 12:110864489-110864511 TGCGGTGGGAGGATCACCTGAGG + Intronic
1102280517 12:111615210-111615232 TGAGGTGAGAGGATCACCTGAGG - Intergenic
1102653460 12:114460525-114460547 TGAAGTGAGACGTGCTCCTGAGG + Intergenic
1103003721 12:117405740-117405762 TGAGGTCAGAGGATCCCCTGAGG - Intronic
1103028341 12:117592344-117592366 TGAAGTGGGAGGATCACCTGAGG - Intronic
1103486686 12:121287872-121287894 TGAGGTGAGAGGATCCCTTGAGG + Intronic
1103648745 12:122416666-122416688 TGCAGTGGGTAGATCACCTGAGG + Intronic
1106456627 13:29933689-29933711 TGCAGTGAGACGATGCATGGGGG - Intergenic
1107418205 13:40220909-40220931 GGAAGTGAGACGATCGCTTGAGG - Intergenic
1108233505 13:48375809-48375831 TGAAGTGAGCAGATCACCTGAGG - Intronic
1109711735 13:66169564-66169586 TGAACTGAGAGGATCTCCTGAGG - Intergenic
1112017067 13:95340194-95340216 TGAGGTGAGACGATCACTTGAGG - Intergenic
1113683306 13:112260345-112260367 TGCAGTGTCACGAGTCCCTGTGG - Intergenic
1116434363 14:44879663-44879685 TGCGGTGAGTTGATCACCTGAGG + Intergenic
1116911179 14:50466142-50466164 TGAAGTGGGAGGATCCCTTGAGG + Intronic
1116920694 14:50570471-50570493 TGAAGTGAGAGGATCACTTGTGG - Intronic
1117003183 14:51392733-51392755 TCCAGTGAGATGTTCCCCTGGGG + Intergenic
1119810524 14:77514083-77514105 TGAGGTGGGACGATCCCTTGAGG + Intronic
1119848561 14:77848696-77848718 TGAGGTGAGAGGATCACCTGAGG - Intronic
1120422387 14:84304328-84304350 TGAAGTGAGTAGATCACCTGAGG + Intergenic
1122117285 14:99534121-99534143 TGATGTGAGAGGATCACCTGAGG + Intronic
1122241343 14:100369894-100369916 TGAAGTGAGAGGATCACCTGAGG - Intronic
1127119770 15:55761305-55761327 TGCAGTGGGTGGATCACCTGAGG - Intergenic
1127592689 15:60442193-60442215 TGCAGTGGGAGGATCACTTGAGG + Intronic
1128588833 15:68876339-68876361 TGCAGTGAGCCGAGACCTTGCGG + Intronic
1128853985 15:70991360-70991382 TGCAGGGAACCAATCCCCTGTGG - Intronic
1129611563 15:77063443-77063465 TGAGATGAGAGGATCCCCTGAGG - Intronic
1129676907 15:77636671-77636693 TGCAATGAGAGGTTGCCCTGGGG + Intronic
1130902346 15:88216533-88216555 AGCAGTGAGACCATCCCTTTTGG + Intronic
1134734814 16:16491333-16491355 TGCGGTGGGAGGATCACCTGTGG - Intergenic
1134749437 16:16614198-16614220 TGAAGTGGGAAGATCACCTGAGG - Intergenic
1134996033 16:18739426-18739448 TGAAGTGGGAAGATCACCTGAGG + Intergenic
1135377470 16:21961061-21961083 TGAGGTGAGAGGATCACCTGAGG - Intronic
1136162339 16:28428594-28428616 TGAAGTGAGTGGATCACCTGAGG - Intergenic
1136174679 16:28508450-28508472 TGAGGTGAGAGGATCCCTTGAGG + Intronic
1136508735 16:30723003-30723025 TGTAGTGAGACAAGCCCCTCGGG + Exonic
1138634655 16:58328063-58328085 TGAAGTGGGAGGATCACCTGAGG + Intronic
1138673700 16:58635665-58635687 TGAGGTGGGAGGATCCCCTGAGG + Intergenic
1138960586 16:62024069-62024091 TGGAGTGAGAAGATCACTTGAGG - Intronic
1139265222 16:65632021-65632043 TGGGGTGAGAGCATCCCCTGAGG - Intergenic
1139808334 16:69589224-69589246 TGCAGTGGGTGGATCACCTGAGG - Intronic
1141466806 16:84211497-84211519 TGCGGTGGGCGGATCCCCTGAGG - Intergenic
1142019473 16:87772198-87772220 TGAAGTGAGTAGATCACCTGAGG + Intergenic
1143130731 17:4675336-4675358 TGCATGGAGATGGTCCCCTGCGG - Exonic
1144226895 17:13157936-13157958 TGCAGTGGGAGGATCACTTGAGG + Intergenic
1144267154 17:13581232-13581254 TGCAGTGGGTGGATCACCTGAGG + Intronic
1144941368 17:18943897-18943919 TGAAGTGGGAGGATCACCTGAGG - Intergenic
1146382393 17:32340844-32340866 TGAGGTGAGAGGATCACCTGAGG + Intronic
1147433055 17:40385888-40385910 TGAAGTGGGACGATCACTTGAGG + Intergenic
1148496406 17:48055645-48055667 GGCAGTCAGATGATCCCCAGGGG - Intronic
1148662519 17:49346316-49346338 TGCAGTGGGCAGATCACCTGAGG + Intronic
1149470332 17:56911030-56911052 TGAAGTGGGAGGATCCCTTGAGG + Intronic
1149508902 17:57220785-57220807 TGAGGTGAGAGGATCACCTGAGG - Intergenic
1150159383 17:62882699-62882721 TGCTGTGAGATAATTCCCTGTGG + Intergenic
1150760059 17:67953488-67953510 TGCAGTGGGTGGATCACCTGAGG - Intronic
1151046804 17:70929968-70929990 TGAGGTGAGAGGATCACCTGAGG - Intergenic
1151116262 17:71738849-71738871 TGACGTGAGAGGATCACCTGAGG + Intergenic
1151604536 17:75128303-75128325 TGAAGTGAGTGGATCACCTGAGG - Intronic
1152061419 17:78078730-78078752 TGAGGTGAGTGGATCCCCTGAGG + Intronic
1152802602 17:82338445-82338467 TGAAGTGAGACAATCTCTTGAGG + Intergenic
1154356908 18:13628336-13628358 TGCAGGGAAACGGTCCCCTGCGG - Intronic
1155481979 18:26298775-26298797 TGCAGTGGGAGGATCTCATGAGG - Intronic
1156883978 18:42112788-42112810 TGCAGTGAGACAATTCTCTATGG - Intergenic
1157573810 18:48730676-48730698 TGCGGTGTGAGGAGCCCCTGAGG + Intronic
1157778110 18:50412789-50412811 TGCAGCTAGACGGTCCCCTCTGG + Intergenic
1158590822 18:58777347-58777369 TGAGGTGAGAGGATCACCTGAGG - Intergenic
1159691592 18:71495015-71495037 TGAAGTGGGAGGATCACCTGAGG - Intergenic
1159764570 18:72472659-72472681 TGAGGTGAGAGGATCCCTTGAGG + Intergenic
1160438869 18:78873563-78873585 TGAAGTGGGACGATCGCTTGAGG - Intergenic
1160759438 19:775558-775580 CGCAGTGGGAAGATCGCCTGAGG + Intergenic
1161836662 19:6652181-6652203 TGAAGTGGGTGGATCCCCTGAGG - Intergenic
1166193493 19:41191629-41191651 TGAGGTGAGAAGATCACCTGAGG + Intergenic
1166836816 19:45672246-45672268 TGAGGTGAGAGGATCCCTTGAGG - Intronic
1167613844 19:50520395-50520417 TGCAGTGGGTGGATCACCTGAGG + Intronic
1167847488 19:52176538-52176560 TGAAGTGGGAGGATCGCCTGAGG - Intergenic
1168335928 19:55597790-55597812 TGCAGTGAAACGGGACCCTGGGG + Exonic
925493938 2:4425243-4425265 TGCAGTGGGCAGATCACCTGAGG + Intergenic
926005341 2:9369249-9369271 TGCAGCGAGTGGATCACCTGAGG - Intronic
926518149 2:13875810-13875832 TGAAGTGAGAGGATCACTTGAGG + Intergenic
928065456 2:28160212-28160234 TGAGGTGGGAGGATCCCCTGAGG - Intronic
928067196 2:28176335-28176357 TGCAGTGGGTGGATCACCTGAGG + Intronic
928084223 2:28335693-28335715 TGCAGGGAGATGACCTCCTGGGG + Intronic
928598885 2:32884378-32884400 TGAAGTGGGAGGATCCCATGAGG - Intergenic
929441595 2:41969547-41969569 TGCAGTGGGTGGATCACCTGAGG - Intergenic
930509253 2:52324338-52324360 TGCAGTGGGAGGATCACTTGAGG - Intergenic
930751197 2:54935930-54935952 TGGGGTGAGAGGATCCCTTGAGG + Intronic
930928841 2:56855780-56855802 TGCTGTGAGATGATACCTTGTGG + Intergenic
932572937 2:72947428-72947450 TGCAGTGAGAAGGTCCCCGCCGG + Intronic
933161131 2:79026323-79026345 TGCAGTGGGAGGCTCCACTGTGG + Intronic
934938451 2:98482039-98482061 TGCAGTGGGAGGATCACTTGAGG + Intronic
935576470 2:104716819-104716841 TGGAGTGAGACCAGCACCTGTGG + Intergenic
935753427 2:106258989-106259011 TGAAGTGAGTGGATCACCTGAGG - Intergenic
937280483 2:120714167-120714189 TGCCATGAGACAATTCCCTGCGG + Intergenic
939278093 2:140027718-140027740 TGCAATTAGACGATCCCATCTGG - Intergenic
942048347 2:172114578-172114600 TGAAGTGGGAGGATCACCTGAGG - Intergenic
942962292 2:181845774-181845796 TGAAGTGGGAGGATCACCTGAGG - Intergenic
943467269 2:188243575-188243597 TGAAGTGAGAGGATTGCCTGAGG + Intergenic
944969764 2:204978727-204978749 TGAAGTGGGAGGATCACCTGAGG + Intronic
945649627 2:212541001-212541023 TGAAGTGGGAGGATCCCTTGAGG + Intergenic
945819313 2:214644203-214644225 TGAAGTGAGAAGATCACTTGAGG - Intergenic
946746802 2:222854432-222854454 TGAAGTGAGCTGATCACCTGAGG + Intergenic
947147817 2:227084897-227084919 TGAAGTGGGAAGATCACCTGAGG + Intronic
947786829 2:232830213-232830235 TGAAGTGAGAGGATCACATGAGG - Intronic
948083557 2:235227301-235227323 TGAGGTGAGAGGATCACCTGAGG - Intergenic
1173220927 20:41132426-41132448 TGCAGTGGGTGGATCCCCTGAGG + Intergenic
1173517623 20:43676149-43676171 TGAAGTGGGAAGATCACCTGAGG - Intronic
1174008762 20:47431825-47431847 TGAAGTGGGAGGATCACCTGAGG - Intergenic
1174025558 20:47571235-47571257 TGAAGTGAGTGGATCACCTGAGG - Intronic
1174907489 20:54566712-54566734 TGAAGTGAGAGGATCTCTTGAGG - Intronic
1177668859 21:24199071-24199093 TGAAGTGGGAGGATCCCTTGAGG - Intergenic
1177719027 21:24880270-24880292 TGAGGTGAGCCGATCACCTGAGG - Intergenic
1177788120 21:25694595-25694617 TGAAGTGAGAGGATCCCTTGAGG + Intronic
1178948897 21:36969803-36969825 TGAGGTGGGACGATCACCTGAGG - Intronic
1179183404 21:39063820-39063842 TGAGGTGAGAGGATCACCTGAGG + Intergenic
1179977518 21:44877351-44877373 TGCAGTGGGCGGATCACCTGGGG - Intergenic
1182131961 22:27860953-27860975 TGAAGTGGGAGGATCACCTGAGG + Intronic
1182529216 22:30942255-30942277 GGCAGTGGGACTATCACCTGTGG + Exonic
1182595773 22:31419045-31419067 TGAAGCGAGAAGATCACCTGAGG - Intronic
1182820248 22:33209879-33209901 TGAAGTGGGAGGATCCCTTGAGG - Intronic
1182846471 22:33435232-33435254 TGCGGTGGGAGGATCGCCTGAGG - Intronic
1183289162 22:36988353-36988375 TGCGGTGAGACGTTCACGTGGGG - Intergenic
1184215025 22:43060961-43060983 TGGGGTGAGAGGATCACCTGAGG + Intronic
1184545599 22:45164725-45164747 TCGAGTGAGACTCTCCCCTGCGG + Intronic
949540871 3:5031156-5031178 TGCAGTGGGCAGATCACCTGAGG + Intergenic
952476026 3:33711490-33711512 TGAAGTGGGCCGATCACCTGAGG - Intronic
954564422 3:51586799-51586821 TGAAGTGAGCAGATCACCTGAGG - Intronic
954730790 3:52659857-52659879 TGAAGTGGGAGGATCACCTGAGG + Intronic
956130828 3:66052287-66052309 TGCAGTGGGTGGATCGCCTGAGG - Intergenic
958043549 3:88254948-88254970 TGAAGTGGGTCGATCACCTGAGG - Intergenic
958868933 3:99533993-99534015 TGAGGTGGGAGGATCCCCTGAGG + Intergenic
958939250 3:100291995-100292017 TGAAGTGAGCAGATCACCTGAGG - Intronic
959540746 3:107535131-107535153 TGCAGTGCCACAATCTCCTGAGG + Intronic
959916846 3:111826067-111826089 TGAAGTGGGAGGATCACCTGAGG + Intronic
960627068 3:119691554-119691576 TGAAGTGAGTGGATCACCTGAGG + Intergenic
962006827 3:131357975-131357997 TTCAATGAGAGGATCCCCTTTGG - Intergenic
964631415 3:158814551-158814573 AGAAGTGAGCGGATCCCCTGAGG - Intronic
966816303 3:183892770-183892792 TGCAGGGAGCCCTTCCCCTGTGG - Intergenic
971153383 4:24057755-24057777 TGCAGTGAGATGAGCCTCTTTGG + Intergenic
971286351 4:25293643-25293665 TGCAGAGAAAAGACCCCCTGAGG - Intergenic
971743115 4:30545336-30545358 TGAGGTGAGAGGATCACCTGAGG - Intergenic
973870074 4:55157695-55157717 TGCCGTGGGACGCTCCGCTGAGG - Intergenic
975555772 4:75663506-75663528 TGAAGTGAGAGGATCACTTGAGG - Intronic
976094794 4:81497252-81497274 TGAAGTGAGCAGATCACCTGAGG - Intronic
976611789 4:87038051-87038073 TGCATTGAGATAATCCCCTGGGG + Intronic
977045051 4:92058907-92058929 TGAAGTGAGAGGATCTCCTCAGG - Intergenic
977532511 4:98216802-98216824 TGCAGTGAGCCGATGCACTCCGG + Intergenic
979056899 4:116006901-116006923 TGAAGCGAGATGATCACCTGAGG + Intergenic
979375543 4:119942265-119942287 TGAAGTGGGAGGATCCCTTGAGG - Intergenic
979811874 4:125046401-125046423 TGCAGTGGGTGGATCACCTGAGG - Intergenic
980676644 4:136092760-136092782 TGAAGTGAGTGGATCACCTGAGG - Intergenic
980931205 4:139184912-139184934 TGAGGTGAGAGGATCACCTGAGG - Intergenic
981595311 4:146414489-146414511 TGAGGTGAGAGGATCACCTGAGG + Intronic
985206090 4:187538655-187538677 TGAAGTGAGCAGATCACCTGAGG + Intergenic
987742644 5:21929613-21929635 TGAGGTGAGAGGATCACCTGAGG - Intronic
988497421 5:31757049-31757071 TGCAGTGGGAGGATCACGTGAGG + Intronic
989782966 5:45291635-45291657 TGAAGTGGGAGGATCCCTTGAGG - Intronic
991003148 5:61803177-61803199 TTCATGGAGAGGATCCCCTGTGG + Intergenic
991554726 5:67882674-67882696 TGAAGTGGGAGGATCACCTGAGG + Intergenic
992311995 5:75511046-75511068 TGCAGCGAGGCAATCCGCTGAGG - Intronic
997111563 5:131080283-131080305 TGCAGTGGGAGGATCACTTGAGG - Intergenic
997183983 5:131862929-131862951 TGCAGTGGGAGGATCACTTGAGG - Intronic
998155581 5:139784989-139785011 TGAAGTGAGCAGATCACCTGAGG - Intergenic
998328721 5:141304742-141304764 TGAGGTGAGAGGATCGCCTGAGG - Intergenic
998862513 5:146458408-146458430 TGAAGTGAGCAGATCACCTGAGG - Intronic
999385981 5:151154760-151154782 GGCAGAGAGATGATCTCCTGAGG - Intronic
1000099424 5:158000966-158000988 TGAGGTGAGAGGATCACCTGAGG + Intergenic
1000668461 5:164028515-164028537 TGAAGTGAGCAGATCACCTGAGG + Intergenic
1000972377 5:167728368-167728390 TGAGGTGAGAGGATCCCTTGAGG + Intronic
1001339330 5:170829080-170829102 TGCAGTGGGCGGATCACCTGAGG - Intergenic
1001894473 5:175366612-175366634 TGCAGCTAGACGCTCCCCTCTGG - Intergenic
1002035818 5:176468698-176468720 TGAAGTGGGAGGATCACCTGAGG + Intronic
1003620349 6:7693938-7693960 TGCAGTGGGAGGATCACTTGAGG - Intergenic
1004549154 6:16629681-16629703 TGAAGTGGGTGGATCCCCTGAGG + Intronic
1004941967 6:20568249-20568271 TGAAGTGGGAGGATCCCTTGAGG - Intronic
1004957684 6:20748254-20748276 TGAAGTGAGAGGATCTCTTGAGG + Intronic
1005301709 6:24477484-24477506 TGAAGTGGGAGGACCCCCTGAGG + Intronic
1005934084 6:30506758-30506780 TGCAGTGGCACGATCTCGTGAGG + Intergenic
1005953525 6:30647874-30647896 TGCAGTGAGACGATCCCCTGGGG + Intronic
1006312911 6:33273824-33273846 TGAAGTGGGCGGATCCCCTGAGG + Intronic
1006700904 6:35972334-35972356 TGAAGTGAGAAGATCACTTGAGG + Intronic
1008565066 6:52759814-52759836 TGAAGTGAGTGGATCACCTGGGG - Intronic
1011736714 6:90317837-90317859 TGCAGTGGGTGGATCCCTTGAGG + Intergenic
1011877635 6:91980746-91980768 TGCAGAGGGACGATCCACAGAGG + Intergenic
1012205344 6:96454587-96454609 TGAAGTGGGAGGATCCCTTGAGG + Intergenic
1020230307 7:6313339-6313361 TGAGGTGAGACGATCACTTGAGG - Intergenic
1021564531 7:22003979-22004001 TGAAGTGAGAGGATCGCCTGAGG - Intergenic
1023010513 7:35921204-35921226 TGCGGTGGGCCGATCACCTGAGG + Intergenic
1023416923 7:39942052-39942074 TGAAGTGGGAGGATCACCTGAGG - Intergenic
1024171103 7:46787816-46787838 TGAAGTGAGAGGATCACTTGAGG + Intergenic
1026013904 7:66657586-66657608 TGAAGCGGGAGGATCCCCTGAGG + Intronic
1026156628 7:67831761-67831783 TGAAGTGAGTGGATCACCTGAGG + Intergenic
1026217772 7:68364798-68364820 TGAAGTGAGAGGATCACTTGAGG - Intergenic
1026399243 7:69992649-69992671 TCCAGTGGGAGGATCCCTTGAGG + Intronic
1026516187 7:71074568-71074590 TGAAGTGGGACGATCACTTGAGG - Intergenic
1026620471 7:71945699-71945721 TGCAGCTAGACGATCTCCTCTGG - Intronic
1026865093 7:73818786-73818808 TGAGGTGAGAGGATCTCCTGAGG - Intronic
1027175496 7:75900407-75900429 TGAGGTGAGAGGATCACCTGAGG + Intronic
1027751167 7:82148867-82148889 TGAGGTGAGTGGATCCCCTGAGG - Intronic
1028971193 7:96860153-96860175 TGAAGTGAGTGGATCACCTGAGG - Intergenic
1029683347 7:102128068-102128090 TGAAGTGGGCCGATCACCTGAGG - Intronic
1030219551 7:107083144-107083166 TGAGGTGAGACGATCCCTTGAGG + Intronic
1032340577 7:131069031-131069053 TGAAGTGAGAGGATCGCTTGGGG + Intergenic
1033447779 7:141437436-141437458 TGCAGAGGGAGGATCCCCTGTGG - Intronic
1034686617 7:152977430-152977452 TGAAGTGGGAAGATCACCTGAGG + Intergenic
1036698956 8:10998646-10998668 TGGAGAGAGCCAATCCCCTGGGG - Intronic
1037090291 8:14907290-14907312 TGAGGTGAGAGGATCCCTTGAGG - Intronic
1037191609 8:16132715-16132737 TGCAGTGGGAAGATCACCTGAGG - Intronic
1038215306 8:25556540-25556562 TGATGTGAGAGGATCCCTTGAGG + Intergenic
1040988229 8:53319513-53319535 TGAAGTGGGAGGATCACCTGAGG + Intergenic
1042176069 8:66037902-66037924 TCCACTGAGAAGATCCACTGTGG + Intronic
1042509373 8:69595267-69595289 TGGAGTGAGAAGATCACCTGGGG - Intronic
1042929418 8:73998441-73998463 TGAAGTGAGAGGATCACTTGAGG + Intronic
1043423123 8:80120845-80120867 TGAAGTGAGCAGATCACCTGAGG + Intronic
1044235860 8:89829306-89829328 TGGAGGGAGAAAATCCCCTGGGG - Intergenic
1044460764 8:92441523-92441545 TGAAGTGGGAGGATCACCTGAGG + Intergenic
1044978373 8:97689939-97689961 TGCAGTGGGTGGATCACCTGAGG - Intronic
1045474673 8:102542727-102542749 TGAAGTGGGAAGATCACCTGAGG - Intergenic
1045506447 8:102782050-102782072 TGAGGTGGGAGGATCCCCTGAGG + Intergenic
1048968546 8:139630980-139631002 TGCAGGGAGCGGAGCCCCTGAGG - Intronic
1048977802 8:139682694-139682716 GGCAGTGACTCGATCTCCTGTGG + Intronic
1051159517 9:14191093-14191115 TGAAGTGGGAGGATCACCTGAGG + Intronic
1053216921 9:36279320-36279342 TGAAGTGGGAGGATCACCTGAGG - Intronic
1054787383 9:69222102-69222124 TGCAGTGGGCAGATCACCTGAGG - Intronic
1055305708 9:74927260-74927282 AGAAGTGAGAGGATCCCTTGAGG - Intergenic
1055453170 9:76449092-76449114 TGAAGTGAGAAGATCCCTTGAGG + Intronic
1056022782 9:82458101-82458123 TTCAGAGAGAGAATCCCCTGGGG - Intergenic
1056225975 9:84495835-84495857 TGAAGTGGGAGGATCACCTGAGG - Intergenic
1057164576 9:92915556-92915578 TGAGGTGAGATGATCGCCTGAGG + Intergenic
1058524426 9:105842820-105842842 CGAGGTGAGAGGATCCCCTGAGG + Intergenic
1058664546 9:107298561-107298583 TGCAGTGGGAGGATCACCTGAGG - Intronic
1058677888 9:107416250-107416272 TGAAGTGGGAGGATCACCTGAGG + Intergenic
1058884478 9:109313006-109313028 CGCAGTGGGAGGATCTCCTGAGG + Intronic
1059402615 9:114079883-114079905 TGAGGTGAGAGGATCACCTGAGG - Intergenic
1060988287 9:127833287-127833309 TGAGGTGAGCCGATCACCTGAGG + Intronic
1185686366 X:1932164-1932186 TGAGGAGAGACGATCACCTGAGG - Intergenic
1188186566 X:27123689-27123711 TGAAGTGAGAGGATCGCTTGAGG + Intergenic
1189660095 X:43287181-43287203 CGCAGTGGGAGGATCACCTGAGG + Intergenic
1190368919 X:49723256-49723278 TGAAGTGGGAAGATCACCTGAGG - Intergenic
1192751004 X:73991076-73991098 TGAAGTGGGAGGATCACCTGAGG - Intergenic
1194639252 X:96382997-96383019 TGAGGTGGGTCGATCCCCTGAGG - Intergenic
1195376692 X:104234741-104234763 TGCAGTGGGAGGATCCCTTGAGG + Intergenic
1197622044 X:128761724-128761746 TGAGGTGAGAGGATCACCTGAGG - Intergenic
1198065843 X:133095975-133095997 TGAAGTGAGTGGATCTCCTGAGG - Intronic
1200233362 X:154457053-154457075 TGAAGTGAGCGGATCACCTGAGG - Intergenic
1201890180 Y:18934936-18934958 TGAGGTGAGAGGATCACCTGAGG - Intergenic