ID: 1005955419

View in Genome Browser
Species Human (GRCh38)
Location 6:30660049-30660071
Sequence CCCCGGACGCAGGTTTCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005955419_1005955426 8 Left 1005955419 6:30660049-30660071 CCACAGGAAACCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1005955426 6:30660080-30660102 CACAGGGGCGTCATCAAAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 105
1005955419_1005955428 19 Left 1005955419 6:30660049-30660071 CCACAGGAAACCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1005955428 6:30660091-30660113 CATCAAAGAAGGTGGAAAAACGG 0: 1
1: 1
2: 2
3: 59
4: 619
1005955419_1005955424 -7 Left 1005955419 6:30660049-30660071 CCACAGGAAACCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1005955424 6:30660065-30660087 TCCGGGGATTCGAAACACAGGGG 0: 1
1: 0
2: 1
3: 2
4: 51
1005955419_1005955427 11 Left 1005955419 6:30660049-30660071 CCACAGGAAACCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1005955427 6:30660083-30660105 AGGGGCGTCATCAAAGAAGGTGG 0: 1
1: 0
2: 1
3: 10
4: 96
1005955419_1005955423 -8 Left 1005955419 6:30660049-30660071 CCACAGGAAACCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1005955423 6:30660064-30660086 GTCCGGGGATTCGAAACACAGGG 0: 1
1: 0
2: 1
3: 0
4: 41
1005955419_1005955429 20 Left 1005955419 6:30660049-30660071 CCACAGGAAACCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1005955429 6:30660092-30660114 ATCAAAGAAGGTGGAAAAACGGG 0: 1
1: 0
2: 2
3: 42
4: 560
1005955419_1005955422 -9 Left 1005955419 6:30660049-30660071 CCACAGGAAACCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1005955422 6:30660063-30660085 CGTCCGGGGATTCGAAACACAGG 0: 1
1: 0
2: 1
3: 2
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005955419 Original CRISPR CCCCGGACGCAGGTTTCCTG TGG (reversed) Exonic
901676930 1:10890799-10890821 GCTCGGAAGCAGCTTTCCTGGGG + Intergenic
902379927 1:16048113-16048135 CCTCTGACGCAGCTTTCGTGGGG - Intronic
915939437 1:160109483-160109505 CCCCTGAGGCAGGTTTGCTTTGG - Intergenic
1071298914 10:84241969-84241991 CTCTGGACCCAGGCTTCCTGGGG + Intergenic
1076866219 10:133167684-133167706 GCCCGGACCCGGGTTTCCTGTGG + Intronic
1077082180 11:729059-729081 CCTCGGACTCAGGGCTCCTGGGG - Intergenic
1078432161 11:11296462-11296484 GCCAGGACCCAGATTTCCTGAGG + Intronic
1086525020 11:87714827-87714849 CCTCAGAGGCAGGGTTCCTGTGG - Intergenic
1090267386 11:125361865-125361887 CCCTGCAGGCAGGTTTCCTGTGG + Intronic
1093479947 12:19593994-19594016 CTCTGAACGCAGGTTTTCTGTGG - Intronic
1096496361 12:52041610-52041632 CCCTGGAAGCAGATTGCCTGGGG + Intronic
1101565601 12:105902052-105902074 CCCTGAATGCAAGTTTCCTGAGG + Intergenic
1101997061 12:109533128-109533150 CCCGAGAGGCAGGTCTCCTGTGG - Intronic
1103900515 12:124301438-124301460 TCCCGGAGACAGCTTTCCTGGGG + Intronic
1121244480 14:92452021-92452043 CCCGGGAGGCAGGCATCCTGGGG + Intronic
1121441618 14:93953317-93953339 CCCCGGAGTGAGCTTTCCTGCGG - Intronic
1122348468 14:101074507-101074529 TCCCTGACCCTGGTTTCCTGGGG + Intergenic
1125363410 15:38888563-38888585 CCCAGGACACAGGCTTCCTCAGG + Intergenic
1125475424 15:40044926-40044948 CCTCTGAGGCAGGTTCCCTGTGG - Intergenic
1128724739 15:69980049-69980071 TCCAGGACGCAGGTTTCCCCTGG + Intergenic
1130053494 15:80503192-80503214 CCCAGCACCCAGGTCTCCTGTGG + Intronic
1132502446 16:290525-290547 CCCCAGATGCAGGTTTGTTGTGG - Intronic
1138348642 16:56334956-56334978 CCCAGCCCGCAGGTTCCCTGGGG - Intronic
1141385039 16:83614304-83614326 CCTCGGATGCAGCTTTCCTGGGG + Intronic
1141699558 16:85636171-85636193 CCCCGGGGGCATCTTTCCTGGGG - Intronic
1151662569 17:75526315-75526337 CCCCGGACGCAGGAAGCCCGCGG + Intronic
1153805722 18:8706724-8706746 CCTCGGCCGCAGGTGTCCCGGGG + Intronic
1153816963 18:8799057-8799079 CCCTGAACGCAGGCTTCCTAGGG - Intronic
1154159791 18:11972590-11972612 CCCCCGATGCAGGTGTCCTGAGG - Intergenic
1155507799 18:26549069-26549091 CCCCAGACACGGGTTTCCCGCGG - Exonic
1155910170 18:31497616-31497638 CCGCGGTCGCAGCTTTCCTGAGG + Intergenic
1159045589 18:63366743-63366765 CGCCGGCCGCAGGGTTCCCGGGG - Intronic
1161772161 19:6236735-6236757 CCCAGGAGGCTGGTTTCCAGGGG - Intronic
1162799473 19:13102901-13102923 CCCCGCCCGCTGGTTTCCTCCGG - Intronic
1165902212 19:39174223-39174245 CCCCAGACCCAGGGTTCCTCGGG + Intronic
1166431656 19:42732953-42732975 CTCCGGACGCAAGCTACCTGTGG - Exonic
1166434773 19:42758171-42758193 CTCCGGACGCAAGCTACCTGTGG - Exonic
1166464335 19:43018939-43018961 CTCCGGACGCAAGCTACCTGTGG - Exonic
1167067095 19:47194679-47194701 GCCCGCAGGCAGGTTACCTGTGG + Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1168663204 19:58183450-58183472 CGACGGACGCAGGTTTCGCGCGG - Intronic
932682394 2:73836903-73836925 CCCGGGGCTCAGGATTCCTGAGG + Intronic
934758786 2:96842065-96842087 CCAGGGGCTCAGGTTTCCTGGGG + Exonic
935336325 2:102020720-102020742 CCACTGACTCAGGTCTCCTGAGG + Intronic
937910752 2:127074402-127074424 CCCCGGGCTCAGGTTTGGTGGGG - Intronic
939894986 2:147780662-147780684 CCCTGGAGGCAGGATTCCTTGGG + Intergenic
1170136272 20:13076863-13076885 CCCAGGAGGCAGGTTCCCGGAGG + Intronic
1173090072 20:39962059-39962081 CCCGGGAGGCAGGCTCCCTGAGG + Intergenic
1176214745 20:63942666-63942688 CCCCCGACCAAGGCTTCCTGGGG + Intronic
1182422584 22:30255880-30255902 CCCTGGGCCCAGCTTTCCTGGGG - Intergenic
1183050074 22:35253777-35253799 CCCCGGACCCAGCTGTCCAGAGG + Intergenic
1184430456 22:44439084-44439106 CCTCTGACCCAGGTATCCTGTGG - Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1184991237 22:48171408-48171430 CACCTGACGCAGGTTAGCTGTGG - Intergenic
954609354 3:51936150-51936172 CCCAGGATGCAGGTTCCCTGAGG + Intronic
956701444 3:71962739-71962761 CCCAGGAGGCACCTTTCCTGTGG + Intergenic
960533310 3:118789302-118789324 CCTCGGATGCAGGAGTCCTGTGG - Intergenic
968086594 3:195876709-195876731 CCCCAGCCGCTGGTTCCCTGTGG - Intronic
974018826 4:56675200-56675222 CCCGTGACTCAGGGTTCCTGTGG - Intronic
981747901 4:148068710-148068732 CCCAGGACGCAGCCTCCCTGTGG + Intronic
985318544 4:188683732-188683754 CCCTGGACTCAGGATGCCTGTGG + Intergenic
999716788 5:154367506-154367528 ACCCGCTCGCAGGTTTGCTGGGG + Intronic
1002110099 5:176902968-176902990 CCTGGGACCCAAGTTTCCTGTGG + Intergenic
1005955419 6:30660049-30660071 CCCCGGACGCAGGTTTCCTGTGG - Exonic
1014653402 6:124069644-124069666 CCCCAGTCCCAGCTTTCCTGTGG + Intronic
1018181823 6:161229810-161229832 CCCCGGAGGAAGGCTTCCTAGGG - Intronic
1036600934 8:10259685-10259707 CCCAGGACTAGGGTTTCCTGGGG + Intronic
1037503317 8:19505914-19505936 CCCCAAACGCATGCTTCCTGTGG - Exonic
1039843090 8:41307539-41307561 GCACAGACGCAGGCTTCCTGAGG - Intronic
1040545570 8:48396205-48396227 CCCAGGAAGCAGGTTCCCTATGG + Intergenic
1041200826 8:55451139-55451161 CCCCCGACCCGGGCTTCCTGTGG - Intronic
1049512941 8:143038904-143038926 CCCCGGACGCTGATGGCCTGTGG - Intergenic
1051540303 9:18208349-18208371 CCCTGGTGGCAGGATTCCTGAGG + Intergenic
1060212794 9:121720724-121720746 CCCAGGAAGCAGGGCTCCTGGGG + Intronic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1062441292 9:136570897-136570919 TCCTGGAAGCAGGTTTTCTGTGG - Intergenic
1062447620 9:136602217-136602239 CCCCGGCCGCAGGAGTCCCGTGG - Intergenic
1062566289 9:137165375-137165397 CCCCGGACCCTGGGCTCCTGTGG + Intronic
1062584170 9:137241571-137241593 CCCTGGCCGCCGGGTTCCTGGGG - Intronic
1062589555 9:137267228-137267250 CCCCGGGCGCAGGTTTCTGCAGG + Exonic
1185456304 X:312558-312580 CCCAGGAGACGGGTTTCCTGTGG - Intronic
1185578655 X:1193450-1193472 CCCCAGAGGCAGGGTCCCTGGGG - Intronic
1200684215 Y:6245368-6245390 ACATGGACCCAGGTTTCCTGAGG + Intergenic
1200686850 Y:6265698-6265720 ACGTGGACCCAGGTTTCCTGAGG + Intergenic
1200989728 Y:9336614-9336636 ACGTGGACCCAGGTTTCCTGAGG + Intergenic
1200992396 Y:9356947-9356969 ACGTGGACCCAGGTTTCCTGAGG + Intergenic
1200995048 Y:9377225-9377247 ACGTGGACCCAGGTTTCCTGAGG + Intronic
1200997713 Y:9397571-9397593 ACGTGGACCCAGGTTTCCTGAGG + Intergenic
1201000223 Y:9466105-9466127 ACGTGGACCCAGGTTTCCTGAGG + Intergenic
1201002884 Y:9486417-9486439 ACGTGGACCCAGGTTTCCTGAGG + Intronic
1201005540 Y:9506700-9506722 ACGTGGACCCAGGTTTCCTGAGG + Intergenic
1201008203 Y:9527030-9527052 ACGTGGACCCAGGTTTCCTGAGG + Intergenic
1201010806 Y:9547215-9547237 ACGTGGACCCAGGTTTCCTGAGG + Intergenic
1201048418 Y:9909018-9909040 ACATGGACCCAGGTTTCCTGAGG - Intergenic