ID: 1005955432

View in Genome Browser
Species Human (GRCh38)
Location 6:30660121-30660143
Sequence CCATTGTGGCTGAAGCCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005955432 Original CRISPR CCATTGTGGCTGAAGCCACC AGG Exonic
900084794 1:886868-886890 CCATGGTGGCTGAGCTCACCGGG + Intergenic
900637951 1:3675008-3675030 CCATTGTGGGAGGAGACACCTGG - Intronic
900637958 1:3675032-3675054 CCATTGTGGGAGGAGACACCTGG - Intronic
900637965 1:3675056-3675078 CCATTGTGGGAGGAGACACCTGG - Intronic
900637972 1:3675080-3675102 CCATTGTGGGAGGAGACACCTGG - Intronic
900637979 1:3675104-3675126 CCATTGTGGGAGGAGACACCTGG - Intronic
900637986 1:3675128-3675150 CCATTGTGGGAGGAGACACCTGG - Intronic
900637993 1:3675152-3675174 CCATTGTGGGAGGAGACACCTGG - Intronic
900638000 1:3675176-3675198 CCATTGTGGGAGGAGACACCTGG - Intronic
900638007 1:3675200-3675222 CCATTGTGGGAGGAGACACCTGG - Intronic
900638014 1:3675224-3675246 CCATTGTGGGAGGAGACACCTGG - Intronic
900638021 1:3675248-3675270 CCATTGTGGGAGGAGACACCTGG - Intronic
900638028 1:3675272-3675294 CCATTGTGGGAGGAGACACCTGG - Intronic
900638035 1:3675296-3675318 CCATTGTGGGAGGAGACACCTGG - Intronic
900638042 1:3675320-3675342 CCATTGTGGGAGGAGACACCTGG - Intronic
902392943 1:16116630-16116652 CCAGTGTGGCTGAAGGCAGAGGG - Intergenic
905365377 1:37448397-37448419 TCAGTGTCCCTGAAGCCACCTGG + Intergenic
905511709 1:38526951-38526973 CCAGAGAGGCTGAACCCACCAGG - Intergenic
907750062 1:57254232-57254254 TCACTGTGGGTGAAGCCACCAGG + Intronic
920668635 1:207986081-207986103 TCAGTGTGGCTGAAGACTCCGGG - Intergenic
920898003 1:210076872-210076894 CCATTGTTGGAGAAGGCACCTGG - Intronic
921394079 1:214650291-214650313 CCATTGTGGCTGGAGCCAGATGG + Intronic
923925502 1:238622353-238622375 CAATGGTGGCTGTAGCCACAAGG + Intergenic
1063438183 10:6051228-6051250 TCATTGTCGGGGAAGCCACCAGG + Intronic
1064862323 10:19840617-19840639 ACATTGTGGCTGAAGGCATGAGG - Intronic
1065742451 10:28809246-28809268 CCATTGTTCATGGAGCCACCCGG + Intergenic
1070369504 10:75768574-75768596 CCAATGTGTCTGATGCTACCTGG - Intronic
1074450550 10:113555927-113555949 CCATTATGGCTGAGCCCAGCTGG - Intronic
1075348657 10:121704216-121704238 CCATTGTGGCTGTAGACTGCGGG - Intergenic
1075815724 10:125263701-125263723 GCAACGTGGCTGAGGCCACCAGG - Intergenic
1076875334 10:133213086-133213108 CCATTGAGGCAGCAGCCGCCTGG - Intronic
1076934070 10:133555778-133555800 ACACTGTGGCTGCAGCCTCCTGG + Exonic
1077329346 11:1977118-1977140 CCATTGTGGCTGAAACCCCCAGG + Intronic
1079825116 11:25181236-25181258 GCACTGTGGCTGATACCACCAGG - Intergenic
1087573174 11:99956842-99956864 CCTTTGTGGCGGAAGACAGCCGG + Exonic
1202812325 11_KI270721v1_random:32297-32319 CCATTGTGGCTGAAACCCCCAGG + Intergenic
1092846020 12:12586056-12586078 CCATGGAGGCTGCAGCTACCTGG + Intergenic
1097068845 12:56340046-56340068 CCTTTGTGGCTGTAGCCGCCCGG + Exonic
1097734089 12:63163063-63163085 CCATTGTTTCTGAAGACACAGGG + Intergenic
1103043003 12:117711415-117711437 CCAATGTGGCTGAAGCTGTCTGG + Intronic
1104429414 12:128704790-128704812 CCTGTGTGGATAAAGCCACCCGG + Intronic
1104774631 12:131384109-131384131 CCCTAGTGCCTGGAGCCACCTGG + Intergenic
1105347957 13:19591091-19591113 CCCTTGTGGTTGGAGCCACAGGG + Intergenic
1107480342 13:40780907-40780929 CACTTGTGGTTGAAGCCACAGGG + Intergenic
1107609552 13:42099469-42099491 GGATTGATGCTGAAGCCACCTGG + Intronic
1107980246 13:45728131-45728153 CCAATGTGGCTGGAGCCAACTGG + Intergenic
1110059515 13:71023603-71023625 CCTTTGTTGGTTAAGCCACCTGG + Intergenic
1113609000 13:111629916-111629938 CCAAGATGGCTGAAGGCACCAGG - Intronic
1114629218 14:24148350-24148372 CCAGTGTGACTGTAGCAACCTGG - Exonic
1117665670 14:58053419-58053441 CCACTGTGCCTGGAGCCAGCAGG - Intronic
1117783377 14:59257771-59257793 CCAATGTGGCTGAAGCCTAATGG - Intronic
1118867729 14:69716622-69716644 GCATTGTGGCTTAAGCCAGTGGG - Intergenic
1121108459 14:91296067-91296089 CCTCTGCGGCTTAAGCCACCCGG + Intronic
1122458886 14:101879240-101879262 CCATTCTGGCCGAGGCCACAGGG - Intronic
1125599580 15:40907846-40907868 CCATACGTGCTGAAGCCACCAGG + Intergenic
1125664663 15:41420756-41420778 CCTCTGTGTCAGAAGCCACCTGG + Intronic
1126036001 15:44546629-44546651 CCATTGTCTCAGCAGCCACCAGG - Intronic
1127142201 15:55989561-55989583 CTGTTGTGGCTGCTGCCACCAGG + Intronic
1127458713 15:59178510-59178532 CCATTCTGACCAAAGCCACCTGG - Exonic
1128546894 15:68574374-68574396 GCATTGTGGCAGAGGCCACAGGG - Intergenic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1132031110 15:98439064-98439086 CTGATGTGGCTGAAGCCTCCCGG + Exonic
1132603222 16:783049-783071 CCATTGTGCCTGAGGTCCCCAGG - Intronic
1133429171 16:5721574-5721596 CCATTGCGTATGATGCCACCTGG + Intergenic
1137673143 16:50291111-50291133 CCAGTGTGGCTCAAGCCTGCAGG - Intronic
1137990762 16:53152465-53152487 CCATTGTGGCTGAAGCAAGGGGG + Intronic
1138865639 16:60815876-60815898 CCAGTGTGGCTGTAGTCACGTGG - Intergenic
1141380818 16:83575095-83575117 TTTTTGTTGCTGAAGCCACCTGG + Intronic
1142268277 16:89075412-89075434 CCAGTGTGGCTGCAGCCAGGAGG + Intergenic
1142908857 17:3069950-3069972 CCACTGGGGCTGAAGCATCCTGG - Intergenic
1142925708 17:3234293-3234315 CCACTGGGGCTGAAGCATCCTGG + Intergenic
1143024799 17:3935240-3935262 CCACAGTGGCTGCCGCCACCTGG - Exonic
1143178546 17:4970233-4970255 CCATTCTGGCTGAGGCCCCAGGG - Intronic
1143866977 17:9931170-9931192 CCTCTGTGACTGAACCCACCTGG + Intronic
1143963883 17:10742200-10742222 AGATTGTGGCTGGAGCAACCGGG - Intergenic
1144575764 17:16428442-16428464 CAGTTGTGGCAGAAGGCACCAGG + Intronic
1145005137 17:19333300-19333322 CCATCTTGGCTGCAGCCCCCAGG - Intronic
1147759569 17:42788585-42788607 CCATTGTGGCTGCTGTCACTTGG + Intronic
1151494156 17:74449588-74449610 TCCTTGTAGCTGCAGCCACCTGG - Intronic
1152308465 17:79535048-79535070 CCAAACTGGCTGAAGCCACGAGG + Intergenic
1156138796 18:34079474-34079496 CCATTGTTGCTGAACCCTTCAGG + Intronic
1156519028 18:37705949-37705971 TCACTGTGGTTGAAGCCAACAGG - Intergenic
1158099922 18:53819266-53819288 CAGTAGAGGCTGAAGCCACCTGG - Intergenic
1161545407 19:4877659-4877681 ACATTGTGGCTCCAGCGACCGGG + Intergenic
1161657102 19:5523090-5523112 CCTATGTGGCTGAAGCCACACGG - Intergenic
1166946890 19:46402905-46402927 CCTGGGTGGCTGAAGCCACGGGG - Intergenic
1167654775 19:50756400-50756422 CCGGTGTGGCTGGAGCCACGTGG - Intergenic
1167656456 19:50767479-50767501 CCGGTGTGGCTGGAGCCACGTGG - Intergenic
926933982 2:18068217-18068239 CCTGTGTGGCTGAAACCAACAGG + Intronic
927211338 2:20640850-20640872 CCAGCCTGGCTGAAGCCTCCAGG + Intronic
930030960 2:47057711-47057733 CCACTGTGGCAGAATCCCCCAGG - Intronic
931923447 2:67045214-67045236 CCCTAGGGGCTGAGGCCACCCGG + Intergenic
932311312 2:70744594-70744616 CCATTGTGGCTGAAGCTGAGTGG + Intronic
932619013 2:73255066-73255088 GCTTTGTGGCTGATGCCAGCAGG - Exonic
932797988 2:74714591-74714613 GCATTGTGGTTGAAGCGCCCTGG - Intergenic
937279319 2:120706448-120706470 CCTTTGTGGCTGCCACCACCAGG + Intergenic
938365369 2:130729322-130729344 CCAGTGTGGCTGCAGCCAGCAGG - Exonic
940259275 2:151763837-151763859 CCCATGTGGCTGAAGCCACAAGG + Intergenic
945014532 2:205501271-205501293 CCAAAGAGGCTGAAGCCACTTGG - Intronic
946194132 2:218023042-218023064 CCTTTGAGCCTGAAGGCACCTGG - Intergenic
947300924 2:228687956-228687978 CCAGTGTTGCTGCTGCCACCAGG - Intergenic
947924857 2:233912649-233912671 CCATTGTGGGTGACCTCACCAGG - Intergenic
948218230 2:236248241-236248263 CCATTATGCCTGAAACTACCAGG - Intronic
1170867405 20:20171489-20171511 CCATTGTGACTGGAGCTAGCAGG + Intronic
1173382744 20:42560790-42560812 ACATTGTGCTTGAAGCCTCCTGG - Intronic
1179953166 21:44723281-44723303 CCACCGTGGCTGAGGCCGCCTGG - Intergenic
1180081363 21:45489287-45489309 CCAGGCTGGCTGAAGGCACCCGG - Intronic
1183732624 22:39627318-39627340 CCTTTCGGGCTGAAGCCACGAGG + Intronic
949559396 3:5188010-5188032 CCGTCGTGGCTGCAGCCGCCGGG + Exonic
949587048 3:5451764-5451786 CTATTGTGGCTTAAGCTACCTGG - Intergenic
952959208 3:38579301-38579323 CCTTTGTCCCTGAAGCCAGCTGG - Intronic
953417130 3:42729116-42729138 CCATTGTGTTTGAAGCCACTAGG + Intronic
953683772 3:45060430-45060452 TCATGGTGGCTGCAGCTACCAGG + Intergenic
954394497 3:50286392-50286414 CCTTGCTGCCTGAAGCCACCTGG + Intronic
954792165 3:53141541-53141563 GCACTGTGGCTGAAGCCAGGTGG + Intergenic
956365176 3:68493832-68493854 CCACTGTGCATGAAGCCTCCAGG - Intronic
959758262 3:109925508-109925530 CCATTGTTGCTGAAGAAATCAGG - Intergenic
960031658 3:113060304-113060326 CCAGTGTGGCTTCTGCCACCTGG + Intergenic
961649535 3:128410527-128410549 CGAATGTGGCTGCCGCCACCAGG + Intergenic
962676924 3:137764513-137764535 CCCTGGTGCCTGAAGCCCCCCGG + Exonic
965450975 3:168837415-168837437 CTATTGTCTCTGAAGCCAACAGG - Intergenic
966833119 3:184028025-184028047 CCATTTAGGCTGAAGCAACCTGG + Intergenic
967299749 3:188001141-188001163 ACAATGTTCCTGAAGCCACCTGG + Intergenic
967904776 3:194490799-194490821 CCATAGTAGATGAGGCCACCAGG - Intronic
969175925 4:5399105-5399127 CAATTGTGGCTGATGCCAACAGG + Intronic
982266634 4:153544069-153544091 CCATTGTTGCTGTGGCCACAAGG + Intronic
986035557 5:3933716-3933738 CCCATGTGCCTGAAGACACCAGG + Intergenic
986372060 5:7089689-7089711 CAATGATGGCTGAAGCCACCTGG + Intergenic
996352930 5:122565216-122565238 CCAATGTGCCTGAAGACATCCGG - Intergenic
999266164 5:150268293-150268315 CCAGTGTGGCTGGAGCTTCCTGG - Intronic
1001401457 5:171448853-171448875 CCCTTCTGGCTGGAGCCATCTGG + Intronic
1002604388 5:180373551-180373573 CCATTGTGGCTGGTGCCAGCTGG + Intergenic
1002989416 6:2224198-2224220 ACATAGTGACTGAAGCCACTGGG + Intronic
1003184589 6:3819988-3820010 CTCTCGTGGCTGCAGCCACCTGG - Intergenic
1003602087 6:7526917-7526939 CCAGTGTGGCTCCAACCACCAGG - Intergenic
1004796080 6:19086578-19086600 CCAATGGGGCTAAAGCCAGCAGG + Intergenic
1005955432 6:30660121-30660143 CCATTGTGGCTGAAGCCACCAGG + Exonic
1006778776 6:36617469-36617491 CCAATGTGTCTGCAGCCAACAGG - Intergenic
1007419946 6:41713269-41713291 CCATCCTGGCTGCAGCCAGCTGG - Intronic
1007705535 6:43788498-43788520 CCAGCATGGCTGAAGCCACGTGG - Intergenic
1008951899 6:57171004-57171026 CCATTCTGGTTCAAGCTACCTGG - Intergenic
1012977104 6:105792464-105792486 CCATGGTGACAGAACCCACCTGG - Intergenic
1017834909 6:158168295-158168317 CTATTGTGGGTGGAGCCAGCCGG - Intergenic
1018479611 6:164176822-164176844 CCACTGTGCCTGAAGCTACAGGG - Intergenic
1018950107 6:168373514-168373536 CCTCTCTGGCTGAAGTCACCAGG + Intergenic
1021215013 7:17905086-17905108 GCATTGTATCTGAAGCCATCAGG - Intronic
1021846955 7:24772212-24772234 CCATAGGGGCTGAATCCACAGGG + Intergenic
1022090037 7:27102109-27102131 CCTTTGTGGCTGAGGCAAGCAGG + Exonic
1023205201 7:37741509-37741531 CCAGTGTTGTTGAATCCACCTGG + Intronic
1025702681 7:63834346-63834368 TCATTGGGCCTGAAGTCACCTGG - Intergenic
1030998786 7:116390324-116390346 CTATTGGGGCTGTAGACACCTGG - Intronic
1034140186 7:148808191-148808213 CCATGGGGGGTGAGGCCACCGGG + Intronic
1034567431 7:151926531-151926553 CCACTGAGGCTGCGGCCACCTGG - Intergenic
1042318784 8:67452904-67452926 CCAATGTGGCTGGAGCCAAGTGG + Intronic
1043102193 8:76060514-76060536 CCTTTGTGGCCGGAGCCTCCCGG - Intergenic
1045648993 8:104325759-104325781 CCATCGTGCCTGAAGACTCCTGG + Intergenic
1046803558 8:118455201-118455223 CCATTGTGTCAGAGGCTACCAGG - Intronic
1047957561 8:129987032-129987054 ACACTTTGGCTGAAGCCACTAGG + Intronic
1050560881 9:6833468-6833490 CTATTGTTTCTGAAGCCACGTGG - Intronic
1053516447 9:38734545-38734567 GCATGGAGGCTGAAGCCACAGGG - Intergenic
1058775780 9:108282345-108282367 CCTTTCTACCTGAAGCCACCAGG - Intergenic
1062502772 9:136858422-136858444 CCTGTGTGGCTGGAGCCACCTGG + Exonic
1190230669 X:48579519-48579541 GCATTGTGGCTAACCCCACCAGG + Intergenic
1199894834 X:152118929-152118951 CCCTTGCGGCTTAAGCCACAGGG + Intergenic
1200836775 Y:7740040-7740062 CCATTGAGGCTGAGGCCACATGG + Intergenic
1201679579 Y:16629161-16629183 CCATTGAGGCAGAATCTACCAGG - Intergenic