ID: 1005958165

View in Genome Browser
Species Human (GRCh38)
Location 6:30679104-30679126
Sequence CTGTGGTCCAGGAGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 0, 2: 7, 3: 90, 4: 622}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005958165_1005958179 16 Left 1005958165 6:30679104-30679126 CCCTCCTCTCTCCTGGACCACAG 0: 1
1: 0
2: 7
3: 90
4: 622
Right 1005958179 6:30679143-30679165 AGGGGGCGCCCTCGGGCCGGCGG 0: 1
1: 0
2: 2
3: 23
4: 213
1005958165_1005958178 13 Left 1005958165 6:30679104-30679126 CCCTCCTCTCTCCTGGACCACAG 0: 1
1: 0
2: 7
3: 90
4: 622
Right 1005958178 6:30679140-30679162 AGCAGGGGGCGCCCTCGGGCCGG 0: 1
1: 1
2: 1
3: 30
4: 258
1005958165_1005958177 9 Left 1005958165 6:30679104-30679126 CCCTCCTCTCTCCTGGACCACAG 0: 1
1: 0
2: 7
3: 90
4: 622
Right 1005958177 6:30679136-30679158 TGACAGCAGGGGGCGCCCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 141
1005958165_1005958171 -3 Left 1005958165 6:30679104-30679126 CCCTCCTCTCTCCTGGACCACAG 0: 1
1: 0
2: 7
3: 90
4: 622
Right 1005958171 6:30679124-30679146 CAGCGCCCGCTCTGACAGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1005958165_1005958172 -2 Left 1005958165 6:30679104-30679126 CCCTCCTCTCTCCTGGACCACAG 0: 1
1: 0
2: 7
3: 90
4: 622
Right 1005958172 6:30679125-30679147 AGCGCCCGCTCTGACAGCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1005958165_1005958173 -1 Left 1005958165 6:30679104-30679126 CCCTCCTCTCTCCTGGACCACAG 0: 1
1: 0
2: 7
3: 90
4: 622
Right 1005958173 6:30679126-30679148 GCGCCCGCTCTGACAGCAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 168
1005958165_1005958176 8 Left 1005958165 6:30679104-30679126 CCCTCCTCTCTCCTGGACCACAG 0: 1
1: 0
2: 7
3: 90
4: 622
Right 1005958176 6:30679135-30679157 CTGACAGCAGGGGGCGCCCTCGG 0: 1
1: 0
2: 4
3: 29
4: 226
1005958165_1005958170 -4 Left 1005958165 6:30679104-30679126 CCCTCCTCTCTCCTGGACCACAG 0: 1
1: 0
2: 7
3: 90
4: 622
Right 1005958170 6:30679123-30679145 ACAGCGCCCGCTCTGACAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005958165 Original CRISPR CTGTGGTCCAGGAGAGAGGA GGG (reversed) Intronic
900791457 1:4683717-4683739 CTGTGGGACAAGTGAGAGGAAGG - Intronic
901377255 1:8848244-8848266 CTGTGGCCAAGCAGAGAGGCAGG + Intergenic
901738525 1:11327527-11327549 CTGTGCTCCTGGAGACAGGTGGG - Intergenic
901763874 1:11487915-11487937 GTGTGACACAGGAGAGAGGATGG - Intronic
901800793 1:11706800-11706822 ATGAGGTCCAGAGGAGAGGAGGG + Intronic
902156091 1:14487700-14487722 TGGTTGTCCAGGAGAGAGGATGG + Intergenic
902162505 1:14542694-14542716 CTGTGGACTAGTAGAGAGTAGGG - Intergenic
902176730 1:14656066-14656088 CTGTGTTCCATGGGACAGGATGG + Intronic
902284729 1:15400074-15400096 CTGAGCTCCAGGAGTGAGAAAGG - Intronic
902575959 1:17377753-17377775 CTGTGACCCAGGTGAGAGGATGG - Intronic
902581056 1:17407886-17407908 CTTGGGTCCAGGCGAGAGGAGGG + Exonic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
902885806 1:19403886-19403908 CTGGAGTCCAGGAGGGAGGCAGG - Intronic
903545044 1:24118706-24118728 CTGTGTCCCAGGAAAGGGGAGGG + Intergenic
904316721 1:29670656-29670678 CTGTGGTCCCAGAGAGGTGAAGG + Intergenic
904895213 1:33812201-33812223 CTGTGGCCCTTCAGAGAGGAGGG - Intronic
905162533 1:36049185-36049207 CTGTGGACTACTAGAGAGGAGGG + Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905316251 1:37083281-37083303 CCAGGGGCCAGGAGAGAGGAGGG + Intergenic
905894095 1:41534120-41534142 CAGTGGTATAGGAGAGAGGGTGG - Intronic
905923011 1:41731578-41731600 CTGGGGTCCAAGAGAGAGCAAGG - Intronic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
907222263 1:52915558-52915580 CAGTGCTCCAGGAGAGAAAATGG + Intronic
907249118 1:53126268-53126290 GTGAGGGCCACGAGAGAGGAGGG - Intronic
907379399 1:54073428-54073450 CTGTGGGCCAGTAGCGAGGAGGG - Intronic
907488449 1:54793135-54793157 CCGTGGTCTATGAGAGAGGCTGG + Intronic
907489837 1:54801693-54801715 CTGAGGACCTGCAGAGAGGATGG - Intergenic
907496586 1:54849366-54849388 CTGCAGTCCAGGTGAGACGATGG - Intergenic
908331663 1:63076892-63076914 CAGTGTTCCAGAAGAGAAGAGGG + Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
909711600 1:78656263-78656285 CAGTGATCCAGGCAAGAGGAAGG + Intronic
909874218 1:80782021-80782043 CTGTTATCCAGGAGAGAGTGTGG - Intergenic
910333484 1:86102729-86102751 CTGTAGTCCAAGAGAGTGGTTGG + Intronic
910726378 1:90344237-90344259 AAGTGTTGCAGGAGAGAGGATGG - Intergenic
910737177 1:90472757-90472779 ATCTAGTCCAGGAGACAGGATGG + Intergenic
910775181 1:90867757-90867779 GTGTGTTCCAGGGGAGAGGTGGG + Intergenic
911514511 1:98850412-98850434 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
912022007 1:105117309-105117331 CTGTGGTACTGCAGAGAGAATGG - Intergenic
912516680 1:110220670-110220692 CTGTTTTTCAGGAGAGAGGGTGG + Intronic
914225923 1:145719581-145719603 CTGGGGTCCAGGTGAAGGGATGG + Intronic
914504972 1:148281050-148281072 CGGTGGGGCGGGAGAGAGGAGGG + Intergenic
914506184 1:148291092-148291114 CTGAGAACCAGGAGAGATGATGG + Intergenic
914507592 1:148303098-148303120 CGGTGGGGCGGGAGAGAGGAGGG - Intergenic
915269433 1:154743156-154743178 GGCTGGTCCAGGTGAGAGGATGG - Intronic
915269455 1:154743248-154743270 CAGTGGTCCAGGTGAGAGGGCGG - Intronic
916030682 1:160875243-160875265 CTGTGTTTCAGGATAGAGAATGG + Intergenic
917240699 1:172945396-172945418 CTGTGGTCCAAGACAGGAGAAGG - Intergenic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
918135896 1:181673748-181673770 CTGTGTTTCAGGAGAGGGGTGGG - Intronic
919938046 1:202268022-202268044 GTGTTCTCCAGGAGAGAGGCTGG + Intronic
920196284 1:204229253-204229275 CTTTGGGCCAGCAGAAAGGAAGG - Intronic
920368477 1:205461524-205461546 CTGTCATCCAGGAAAGTGGACGG - Intergenic
920404512 1:205699001-205699023 CTGTAGTCCAGGTGGGAGTAGGG - Intergenic
920514203 1:206572439-206572461 CTGGGATGCAGCAGAGAGGAAGG + Intronic
921029535 1:211325625-211325647 TTGTGGTCATGGAGAAAGGAGGG - Intergenic
921286198 1:213611539-213611561 GTGTTATCCAGGAAAGAGGAGGG + Intergenic
922195208 1:223353723-223353745 CGGTGCCCCAGGACAGAGGAAGG + Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922603629 1:226875121-226875143 CTGTGGTCCGGGAGGGTGGTAGG + Intronic
922971520 1:229745277-229745299 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
923034987 1:230279478-230279500 CAATGGTGCAGGAGACAGGACGG - Exonic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
923929797 1:238682428-238682450 CTGTGGTCCAAGAGGGTGGCTGG - Intergenic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1062923582 10:1297869-1297891 CTGGAGGCCAGGAGAGAGGGTGG + Intronic
1063244637 10:4205571-4205593 CTGTCTTTCAGGAGAAAGGACGG + Intergenic
1064276812 10:13913897-13913919 CTGTAGCTCAGGATAGAGGACGG + Intronic
1065126404 10:22578418-22578440 ATGGGGTTCAGGAGAGAGAAAGG - Intronic
1066243222 10:33557889-33557911 CTGTGGTCCATGAGACAGCATGG + Intergenic
1067342899 10:45419035-45419057 CTGTGGTCCTGGGGAGAGGGCGG - Intronic
1068262211 10:54597239-54597261 CTGTTGTCCAAGAGAGTGGTTGG - Intronic
1068669270 10:59708259-59708281 ATTTGGTCCAGGAAAGTGGAAGG + Intronic
1069248324 10:66236873-66236895 AGGAGGTCAAGGAGAGAGGACGG + Intronic
1069617730 10:69816855-69816877 GAGTGGTCCAGGAGAGACGTAGG + Intronic
1069780062 10:70949722-70949744 CAGTGGTCTAGGAGAGAGGGAGG + Intergenic
1070282086 10:75057371-75057393 CTGGAGTCCGGGAGAGTGGAGGG + Intronic
1070321947 10:75361004-75361026 CTGTGGTGCAGGAGACAGCAGGG + Intergenic
1071384443 10:85105220-85105242 CTTTGGTCCTGGAGTGAGAAAGG - Intergenic
1072001286 10:91198238-91198260 CTGAGGTCAGGGAGACAGGATGG - Intronic
1072368707 10:94742232-94742254 CTGTGGTTCAGGAGTGTGGTTGG + Intronic
1072509814 10:96109278-96109300 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1072663886 10:97380349-97380371 CCGTAGTCCAGGAGAGAGTGGGG - Intronic
1072883433 10:99250646-99250668 CTGTGGTCCAGGAGTATGGTTGG - Intergenic
1073512474 10:104051491-104051513 CTGTGGGCCAGGAGAGCCGCTGG + Exonic
1074544852 10:114394433-114394455 CTGGGGACCAGGAGAGAGTTGGG + Intronic
1074770742 10:116731988-116732010 AAGTGGTCCTGCAGAGAGGAGGG + Intronic
1074882224 10:117668003-117668025 CTGGGGTCCAGCAGAAAGGAAGG + Intergenic
1074915423 10:117950713-117950735 CTGTGAGCCAGGAGAGCAGATGG + Intergenic
1075264258 10:120987494-120987516 CAGTGGTTCAGAAAAGAGGAAGG + Intergenic
1075392663 10:122103783-122103805 TTGTCTTGCAGGAGAGAGGAAGG + Intronic
1075680107 10:124325478-124325500 CTATGATCGTGGAGAGAGGAGGG + Intergenic
1075722855 10:124597607-124597629 CAGTGGCCCAGGAGAAAGCAGGG - Intronic
1076757232 10:132578920-132578942 CTGTGGTGCAGGGTAGAGGTCGG + Intronic
1076833563 10:133008784-133008806 CTGGAGTCCAGGAGAGTGCAGGG - Intergenic
1076849857 10:133087426-133087448 CTGTGGCCCAGGATGCAGGAGGG + Intronic
1076876671 10:133219665-133219687 CTGGAGTCCAGCAGAGAGCAAGG + Intronic
1077016083 11:399677-399699 CGGGGGTCCAGGAAAGAGGCGGG - Intronic
1077185081 11:1232214-1232236 CCGTGGCCCAGGGGACAGGAAGG - Intronic
1077543483 11:3158672-3158694 CAGTGGTGCAGGAGAGAGGGAGG + Intronic
1077767391 11:5175086-5175108 CTGTGGTCCAGGCTAGAGTGAGG + Intronic
1077831710 11:5879688-5879710 CTGTGGTCCAAGAGAGATTCTGG - Intronic
1077852958 11:6092929-6092951 CTGTGGTCCAGGAGAGTGGTTGG + Intergenic
1078170627 11:8926490-8926512 CTGTAGTCCAGGAGGCAGGGAGG - Intronic
1078549756 11:12272034-12272056 CTGGGCTCCAGGAGGGTGGAGGG - Intergenic
1078565845 11:12413339-12413361 CTGTGCTCCAGGGGAAGGGAAGG + Intronic
1079088577 11:17464813-17464835 ATCTGGTCTAGGAGGGAGGAGGG - Intronic
1079423923 11:20322335-20322357 CTGTGGTCCTCTAGAGAGGACGG + Intergenic
1080076140 11:28152091-28152113 GTGTGGTCCAGGAGACAGAAGGG - Intronic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1080737448 11:35030715-35030737 CTGTGTTCCTGGCGAGAGGCTGG + Intergenic
1081674211 11:44958962-44958984 CCATGGTCCTGGAGTGAGGAAGG + Intergenic
1081965154 11:47164936-47164958 CTGGGTGCCAGGAGAGGGGAAGG - Exonic
1082183795 11:49154370-49154392 CTGTGGCCCAGGTTCGAGGAGGG - Exonic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083097711 11:60268547-60268569 CAGTAGTCCAAGAGAGAGGATGG - Intergenic
1083317548 11:61825977-61825999 CAGTGCTCGAGGAGAGGGGAGGG - Intronic
1083393771 11:62374350-62374372 CTTGGGTCCAGGCAAGAGGAGGG - Intronic
1083527005 11:63377347-63377369 TTGTGGTCCAGGAGTGTGGTTGG - Intronic
1083596756 11:63921255-63921277 CTGTTGTCCAGGTGAGGGCAAGG - Intergenic
1083800551 11:65044126-65044148 GCGTGGTCGAGGAGAGAGGAAGG + Intronic
1084168648 11:67389661-67389683 CAGTCATCCAGGTGAGAGGATGG + Intronic
1084272189 11:68035030-68035052 CTGTGGCCCAGGATGGAGTATGG - Intronic
1084592941 11:70100942-70100964 CGGTGGTGCTGGGGAGAGGATGG + Intronic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1085041950 11:73331722-73331744 CTGTTGTCCTGGAGAGAGAGAGG + Intronic
1085205018 11:74726494-74726516 ATGGGGTCCTGGACAGAGGAAGG + Intronic
1085297913 11:75441311-75441333 CTGTGGGGCAGGGGAGAGGCAGG + Intronic
1085726483 11:78959494-78959516 TTGGGTTTCAGGAGAGAGGAAGG + Intronic
1085731640 11:79004406-79004428 CTGTGGTCCAAGAGCGTGGTTGG - Intronic
1085950225 11:81321640-81321662 TTGTGTTCCAGGAGATGGGATGG + Intergenic
1086682564 11:89690982-89691004 CTGTGGCCCAGGTTCGAGGAGGG + Intergenic
1087629285 11:100631564-100631586 CTGTGGAGCAGAAGACAGGAAGG + Intergenic
1087918183 11:103834209-103834231 CTGTGGTCCAGGAGTGTAGTTGG - Intergenic
1088182227 11:107126105-107126127 GGATGGTCCAGGAGGGAGGAAGG - Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088706849 11:112471567-112471589 CTGTGGTCAAGGAGGCAGTATGG - Intergenic
1089051390 11:115548978-115549000 CTGTGGACCAGGTAAGAGGGAGG + Intergenic
1089536537 11:119163753-119163775 CTCAGGCCCAGGAGAGAAGAGGG - Intergenic
1089603803 11:119630120-119630142 CTGTGGTCCAGAAGCAAGGGTGG + Intronic
1090271200 11:125387515-125387537 ATGTTGGCCAGGAGAGAGCATGG - Intronic
1091108921 11:132947088-132947110 AGCAGGTCCAGGAGAGAGGAAGG - Intronic
1091127915 11:133118482-133118504 ATTTGGTCAAGGAGACAGGATGG + Intronic
1091150607 11:133325053-133325075 CTGTCCTCCTGGAGAGGGGAGGG + Intronic
1091241272 11:134053906-134053928 CTGTGGCCCAGAGGAGGGGAGGG + Intergenic
1091657244 12:2354629-2354651 CTGGAGGCCAGGAGAAAGGATGG - Intronic
1091668057 12:2433356-2433378 CCCAGGTGCAGGAGAGAGGAGGG + Intronic
1091696308 12:2630475-2630497 GTGTGGTCCAAGTGGGAGGAAGG + Intronic
1091838823 12:3604826-3604848 CTGTGGCCCAGGCAGGAGGAGGG - Intergenic
1092631295 12:10380813-10380835 CTGTGTTCCAGAGAAGAGGAGGG - Intronic
1093276313 12:17132495-17132517 CTGTGGGCCATGACGGAGGAGGG + Intergenic
1093541813 12:20296587-20296609 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1093823005 12:23644669-23644691 CTATGATACAGGAGAGAGAAGGG + Intronic
1093850712 12:24034346-24034368 CTGAGAGGCAGGAGAGAGGAGGG - Intergenic
1095953037 12:47791777-47791799 CTGGGGCCCATGAGAGATGAGGG - Intronic
1095985440 12:47996127-47996149 CTGCTGTCCAGGAGAAAGCAAGG - Intronic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096580070 12:52579472-52579494 CTGGGCTGCAGCAGAGAGGAGGG - Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1099394781 12:82123889-82123911 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
1099454567 12:82848250-82848272 CTCTGGGACAGGAGAGAGCATGG - Intronic
1100837570 12:98581210-98581232 CTGTGGGGCAGGAGAGTGGTGGG + Intergenic
1101058588 12:100946878-100946900 GTGTGGTTCAGGAGAGATGGAGG + Intronic
1101718955 12:107334622-107334644 CTCGGATTCAGGAGAGAGGATGG + Intronic
1101954284 12:109199635-109199657 CAGTGGTCAAGGGGAGAGGTAGG - Intronic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102069983 12:110010604-110010626 CTGGGCTCCAGGAGACAGGAAGG + Intronic
1102394417 12:112574745-112574767 GTGTGGTGGAGGAGAGAGAAGGG + Intronic
1102930794 12:116860601-116860623 TTGGGGTCTAGGAGGGAGGATGG - Exonic
1103818414 12:123677697-123677719 CTGTGGTGCAGGGGAGAAGGTGG - Intronic
1104532305 12:129583318-129583340 CTGTGGTCTAGTGGAGAGGGAGG + Intronic
1104815654 12:131644174-131644196 CTGTGGCCCTGAAGAGAGGAAGG + Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105819048 13:24063462-24063484 ATGTGGGCCAGGGGAGAGGATGG - Intronic
1105824522 13:24110267-24110289 CATTGGTCAAGGAGTGAGGAAGG + Intronic
1108705260 13:52979734-52979756 CAGTGCTCCAGAAGACAGGAGGG - Intergenic
1109317980 13:60774394-60774416 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111842351 13:93465931-93465953 CTGTGTTTCAGGAAACAGGAAGG + Intronic
1112302093 13:98239855-98239877 CTGTGCTAGAGGAGAGAGAAAGG + Intronic
1112547991 13:100390412-100390434 CTGTGGCCCAGGAGAGAGTTTGG + Intronic
1112610573 13:100951103-100951125 CTGTGTTCCAGGAGAAGAGATGG + Intergenic
1113351775 13:109536342-109536364 CAGTGATCCAGAAGAGAAGAGGG + Intergenic
1113659861 13:112098781-112098803 CCCTGGTGCAGGAGAGAGCAGGG - Intergenic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1113673189 13:112188868-112188890 CTGTAGACTAGGAAAGAGGAAGG + Intergenic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1114141564 14:19917219-19917241 GTGAGGTCCAGGAGAAAGGTAGG + Intergenic
1114258820 14:21023591-21023613 TTTTGGTCCAGGGCAGAGGAGGG - Intronic
1114416857 14:22550649-22550671 CTGTGGTCCAGCTGAGGTGAGGG + Intergenic
1115351906 14:32404912-32404934 CTGTATTCCAGGAGGGAGGGAGG + Intronic
1115868557 14:37775578-37775600 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116128840 14:40826712-40826734 CTGTGGTCCAAAAGAGTGGTTGG - Intergenic
1117303289 14:54449204-54449226 TGGGGGTCTAGGAGAGAGGAGGG - Intergenic
1118068708 14:62221602-62221624 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1118367620 14:65109178-65109200 CTGTGGCCCACGAGAGATGGCGG - Intergenic
1118456182 14:65947373-65947395 ATGTGTTCTAGGAGAGAGAAGGG - Intergenic
1119386340 14:74260074-74260096 CTCTGGCCAAGGGGAGAGGAGGG - Intronic
1119400782 14:74360765-74360787 ATGTGGGCCAGGAGAGACAATGG - Intergenic
1119406490 14:74402590-74402612 CTGTGGTCCAGGACAGCTGCTGG - Intergenic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120813038 14:88824659-88824681 CAGCGCTCCAGGAGAGAGGTGGG - Exonic
1121009084 14:90509445-90509467 CTGGGGTCCAGGAGGGAGAAAGG - Intergenic
1121443944 14:93966916-93966938 CTGTGGTCCACACTAGAGGAGGG + Intronic
1122155358 14:99747332-99747354 CTCTGGCCCAGGAGAAAGGCAGG + Intronic
1122253198 14:100455439-100455461 TTGAGCTCCAGAAGAGAGGAGGG + Intronic
1122955811 14:105070456-105070478 CTGTGTTCCAGGAATGAGGAAGG + Intergenic
1123067832 14:105627198-105627220 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123071850 14:105645923-105645945 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123072642 14:105649219-105649241 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1123091514 14:105744199-105744221 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123092668 14:105748745-105748767 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1123097282 14:105772540-105772562 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123098228 14:105776446-105776468 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1124402368 15:29360730-29360752 CTATGTTCCAGGAGAGAGCAAGG - Intronic
1124483471 15:30097375-30097397 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124489922 15:30149437-30149459 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124520107 15:30399851-30399873 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124538548 15:30566373-30566395 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124753610 15:32388890-32388912 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124760103 15:32441209-32441231 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124975351 15:34524592-34524614 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1125444243 15:39736606-39736628 CTGTGGCCCACGGGGGAGGAGGG - Intronic
1126789586 15:52209009-52209031 CAGAGGACGAGGAGAGAGGATGG + Intronic
1126873052 15:53010154-53010176 CTGGAGTTCAGGAGAGAGGCTGG + Intergenic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1127369882 15:58329920-58329942 CTGTAGGCCAGGAGCCAGGATGG - Intronic
1127728933 15:61780256-61780278 CTGTGGTACAGGAGATACCAAGG + Intergenic
1128697659 15:69780640-69780662 ATGTGGTCCAAGAGAGGTGAAGG + Intergenic
1129442492 15:75591880-75591902 CTGTGCAGCAGCAGAGAGGAGGG + Intergenic
1129682179 15:77664103-77664125 CTGTGTGGCAGAAGAGAGGAAGG - Intronic
1129906286 15:79189936-79189958 TTGTGAGCCAGGAGAGAAGATGG + Intergenic
1131106459 15:89737963-89737985 CTGTGGTCCAGGTGAGCAGGTGG - Intronic
1131448392 15:92518654-92518676 TTGTGGTCTAGAAGAGAGGGTGG + Intergenic
1131520334 15:93109666-93109688 TTGTGCTCCTGGAGAGGGGAAGG + Intergenic
1132185003 15:99796674-99796696 CTGTGGACCAGGTGAGGGCACGG + Intergenic
1132315447 15:100886893-100886915 TTGTGGTCCAAGAGTGAGAATGG - Intronic
1132372430 15:101307974-101307996 CTGTGGTCCAGGATAAATGCTGG - Intronic
1132431985 15:101767880-101767902 CTGTGGACCAGGTGAGGGCACGG - Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132582402 16:691023-691045 CCGAGGTCGAGGAGTGAGGAAGG - Intronic
1132603098 16:782608-782630 CTGTGGCCCAGGAGGGAGACAGG + Intronic
1132639982 16:973519-973541 CTGTGGTCCAGGTCTGGGGACGG + Intronic
1133110089 16:3542908-3542930 CTGTTGCCCTGGAGTGAGGAAGG - Intronic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1133440410 16:5816391-5816413 CCTTGGTCAAGGAGAGAAGACGG - Intergenic
1134201373 16:12202359-12202381 ATGTGGTCCAGAAGTGAGGTTGG + Intronic
1134333555 16:13272465-13272487 CTGAGGTCGAGGTGGGAGGATGG - Intergenic
1134596413 16:15499572-15499594 TTGTGGTTCACGAGAGGGGAAGG + Intronic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1135403315 16:22181101-22181123 GTGGCGTCCAGGTGAGAGGAGGG + Intronic
1136647928 16:31638858-31638880 CTGTGGTCCAGGAGTGTGGTTGG + Intergenic
1137629120 16:49929839-49929861 CTCAGGTCCAGGAGAGGGAATGG + Intergenic
1137636117 16:49988029-49988051 CTGTCGTCCAGGAAGGAGTACGG - Intergenic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1138776748 16:59732216-59732238 CTGTGGTCCAAGAGTGTGGTTGG - Intronic
1139293979 16:65883983-65884005 CTCTAGGCAAGGAGAGAGGAAGG + Intergenic
1139476829 16:67207020-67207042 CTGTGGGCCAGGCCTGAGGAAGG + Intergenic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1140961839 16:79921026-79921048 ATGTGACCCAGGAGAGAAGAAGG + Intergenic
1141047081 16:80725027-80725049 GTGTGGTCCAGGAGTGGGGCAGG - Intronic
1141625467 16:85259045-85259067 TCTTGGTCCTGGAGAGAGGAGGG + Intergenic
1141633003 16:85299001-85299023 CTGTCCTCCAGCAGCGAGGACGG - Intergenic
1142158671 16:88545959-88545981 CTGAGGTCCAGGCGTGAGCAGGG - Intergenic
1142186564 16:88697626-88697648 CTGTAGTCCTGGAGACAGGAAGG + Exonic
1142221658 16:88857785-88857807 ATGTGGGCCAGTAAAGAGGATGG - Intronic
1142492704 17:289069-289091 CTTTGGGGCAGGAGAGAGCAGGG + Intronic
1143090955 17:4448916-4448938 ATTTGGTCCTGCAGAGAGGAGGG + Intronic
1143310314 17:5982345-5982367 CCCTGGCCCAGGAGGGAGGAAGG + Intronic
1143310441 17:5983576-5983598 CCCTGGCCCAGGAGGGAGGAAGG - Intronic
1143706201 17:8699133-8699155 GTGTGGTCCAGGAGGGAGATAGG + Intergenic
1143864979 17:9917123-9917145 CAGTGGCCCAGGAGAGAGGGTGG + Exonic
1144049529 17:11486695-11486717 CTGGGGTGCAGGAAAGATGAAGG - Intronic
1145166089 17:20614322-20614344 CTCTGGTTCAGGAGTGTGGAGGG - Intergenic
1145242372 17:21247530-21247552 CCGAGGCCCAGGAGGGAGGAAGG + Intronic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1146400737 17:32498161-32498183 CCGTGGTCCAGGAGAGGGACAGG - Intronic
1146490774 17:33280062-33280084 CTATGTGCCAGGAGTGAGGAGGG - Intronic
1146574453 17:33979104-33979126 CTCATGACCAGGAGAGAGGAGGG + Intronic
1147667285 17:42156641-42156663 CTGGGGTGCAGGGGAGAGAAGGG + Intergenic
1148079957 17:44962227-44962249 CTCCAGCCCAGGAGAGAGGATGG - Intronic
1148211697 17:45812775-45812797 AAGTGGGCCAGGAGAGAGGTGGG - Intronic
1148457749 17:47820097-47820119 CTGCAGTCCAGGACAGAGGGAGG + Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1149430495 17:56593264-56593286 CATTGCTCCAGGAGAAAGGAGGG + Intergenic
1149830594 17:59868319-59868341 ATGTGATCCAGGAGGGAGCAAGG - Intronic
1149891126 17:60391721-60391743 GTGTGGTGGAGGAGAGAGGTCGG - Intronic
1149895086 17:60422813-60422835 CTGTGTTCCTGGCGAGATGATGG + Intronic
1150050108 17:61953524-61953546 CTGGCATCCAGGATAGAGGAAGG + Intronic
1150295466 17:64005063-64005085 CTCTGTCCCAGGGGAGAGGAGGG + Intronic
1150480434 17:65504718-65504740 CTGTGAGCCTGGAGAGAGGGAGG - Intergenic
1150865264 17:68842514-68842536 CTGTGGTCAATGATAGAGGTAGG + Intergenic
1151191179 17:72399319-72399341 TAATAGTCCAGGAGAGAGGATGG + Intergenic
1151615629 17:75208571-75208593 CTGGGGTCCAGGGGAGATGCTGG + Exonic
1151937347 17:77270761-77270783 CTGTCGTCCAGGATAGAGTGCGG + Intergenic
1152037797 17:77883933-77883955 CTGTAGTCCAAGAGAGAGGCAGG - Intergenic
1152174736 17:78780384-78780406 CTGTAGTCCAGGTTACAGGAGGG + Intronic
1152854344 17:82655668-82655690 CTGTGGCACAGCAGAGAGAAGGG + Exonic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1153081689 18:1234081-1234103 CTGTTGTCCAGGAGAGTGGTTGG + Intergenic
1153377426 18:4396480-4396502 CTGAAGTCCAAGAGATAGGAAGG + Intronic
1154041430 18:10859858-10859880 CTGTGCTGGAGGAGAGGGGAGGG + Intronic
1155231443 18:23778798-23778820 GTGTGGGCCAGCAGAGAAGATGG + Intronic
1155315426 18:24566467-24566489 CTGTAGACGAGGAGAGAGAAAGG + Intergenic
1155779605 18:29814222-29814244 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1156303829 18:35858474-35858496 GTGGGGTCCAGAAGAGAAGAAGG + Intergenic
1156381586 18:36566692-36566714 CTATTGTCCAGGAGAGATCATGG + Intronic
1156398886 18:36723134-36723156 CAGAGACCCAGGAGAGAGGAAGG - Intronic
1156593626 18:38520402-38520424 CTGTGTTAAAGGAGATAGGAAGG + Intergenic
1156858322 18:41808701-41808723 CTGAGGCCCAGGATAAAGGAGGG + Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157030751 18:43904721-43904743 CTGTAGTCAAGTAGAGATGAGGG + Intergenic
1157099434 18:44716019-44716041 CTGGGCTCCAGGAGAAGGGAGGG - Intronic
1157315206 18:46581175-46581197 CAGTAGTCTAGAAGAGAGGATGG + Intronic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1158405801 18:57158127-57158149 CTGTGGCCAAGGAGAGATGCAGG - Intergenic
1158887305 18:61840425-61840447 CTGTGGCACAGGGCAGAGGATGG + Intronic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159358189 18:67364140-67364162 CTGTGGGCCATGATAGAGGCTGG + Intergenic
1159830948 18:73277968-73277990 TTGTGGTCCAGAAGAGAGTGAGG + Intergenic
1160212083 18:76889381-76889403 CTGTGGTCTAGGGGAGAAGCGGG - Intronic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160490422 18:79333101-79333123 CTGATGCCCAGGAGAGATGATGG + Intronic
1160572479 18:79827534-79827556 CTGTGTTCCTGGAGGAAGGAGGG + Intergenic
1161327429 19:3670516-3670538 CTGAGGTCCAGGAGTGGGCAGGG - Intronic
1161475716 19:4483691-4483713 ATGGTGTCCAGGAGAGAGCAAGG - Intronic
1161830985 19:6604074-6604096 CTGAGTTCCAGGAAACAGGAAGG + Intronic
1162240850 19:9352973-9352995 CAGTGGTCCAAGATAGAGAAGGG + Intronic
1162343773 19:10107941-10107963 CTGTAGGACAGGAGAGAGGAGGG - Intronic
1162392499 19:10397997-10398019 CTGAGGTTCAGGAGAGGTGATGG - Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1163197578 19:15733889-15733911 CAGTGGCCCAGGAGAGGGGATGG + Intergenic
1163223861 19:15940900-15940922 CAGCAGTCCAGGAGAGAGGATGG + Intergenic
1163495339 19:17643354-17643376 CTGTGGTCCAGGTTAGAGTGCGG + Intronic
1163808816 19:19417533-19417555 CTGAGGTCCAGGAGGGTGAATGG - Intronic
1164117354 19:22235330-22235352 GTGTGGTCCAGAAAAGAAGAAGG - Intergenic
1164462510 19:28461200-28461222 CTCTGGACCATGAGACAGGAAGG - Intergenic
1165038913 19:33055014-33055036 CTGTGGCCTTGGAGAGGGGAGGG - Intronic
1165094475 19:33402789-33402811 CTGGGGGCCAGCAGAGAGGCAGG + Intronic
1165319381 19:35076063-35076085 CTGAGGTCCGGGAGCCAGGAAGG - Intergenic
1165426787 19:35750255-35750277 CGGGGGTTCAGGAGAGAGGCTGG + Intronic
1165757723 19:38304126-38304148 CTGAGGACCAGGACAGAGGTTGG + Intronic
1165956277 19:39503785-39503807 CTGTGCTCTTGGAAAGAGGATGG - Intronic
1166286959 19:41837042-41837064 CTGTGGTCCATGAGAGAGCAGGG - Intergenic
1166918000 19:46208944-46208966 CTGTGGGCAAGAAGAGAGGCGGG + Intergenic
1167123279 19:47531844-47531866 CTGAGATGCAGGAGAGAGAAGGG - Intronic
1167284107 19:48589134-48589156 CCGGGGTCCAGGGGAGGGGACGG + Intronic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1168309508 19:55453257-55453279 CTGAGGTCCGGGTGACAGGAGGG + Exonic
1168523081 19:57068104-57068126 CTGAGGTCCAGTAGCCAGGATGG - Intergenic
925046759 2:778231-778253 CTGTGGTCCTGGACACAGGAGGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925222063 2:2149905-2149927 CTGTGGTCCAGATGAGAGACAGG - Intronic
925636447 2:5945873-5945895 CTGTGGCCCAGCAGTGAGGGAGG + Intergenic
925754356 2:7119533-7119555 TTGTGGTCCAGGAGACAAGGAGG - Intergenic
926056338 2:9776220-9776242 CTGGCCTCCAGGAGGGAGGAGGG - Intergenic
926364117 2:12117291-12117313 CTGAGGTCCAGGAAAGGGAATGG + Intergenic
926423841 2:12723646-12723668 CTGTGGTCCAGATGAGGGGAAGG + Intronic
927307531 2:21590638-21590660 CTGGGGAGCAGAAGAGAGGAAGG - Intergenic
927783722 2:25958192-25958214 CAGTGGTCCAGGAGAGTTGTGGG - Intronic
928092435 2:28383211-28383233 CCATGGTTCAGGAGAGAGGTAGG - Intergenic
928393480 2:30926847-30926869 TTGGGGGCCAGGAGAAAGGAGGG + Intronic
928404091 2:31001112-31001134 CTGTGGTCCTGGAGATAGCCTGG - Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929960998 2:46496338-46496360 GTATGGTCTAGGAAAGAGGAAGG - Intronic
930097045 2:47572682-47572704 CTGTGCTCCAGAAAAGAGGGAGG - Intergenic
930169895 2:48240695-48240717 CTGGGGCCGATGAGAGAGGAAGG + Intergenic
930781035 2:55224939-55224961 CAGTGGTCCAGAAAAGAGGCTGG - Intronic
931409297 2:62013578-62013600 CAGTGGTCCAGGTGAGATAACGG + Intronic
931543669 2:63356565-63356587 CTGTGGTCCAGGAGTGTGTTTGG - Intronic
931552523 2:63462349-63462371 ATGGGGTCGAGGAGAGGGGAGGG + Intronic
931630886 2:64297647-64297669 CTGGGGGCCAGGAGAGATGTGGG - Intergenic
931667275 2:64618326-64618348 CAGTGGGGCAGGAGAGAGCAGGG + Intergenic
931777912 2:65555980-65556002 CTTTGGACAAGGAGAGACGAGGG - Intergenic
931830587 2:66046988-66047010 CTGGGATCCAGTAGGGAGGAAGG + Intergenic
933901505 2:86853620-86853642 TTGGTGTCCTGGAGAGAGGAAGG + Intronic
934136027 2:88997346-88997368 CTCAGGTCCTGGAGTGAGGAGGG - Intergenic
934218854 2:90062593-90062615 CTGTGGTCCAAGAGAGAGGTTGG + Intergenic
934559159 2:95303405-95303427 CTGTGTTCAGGGGGAGAGGAAGG + Intronic
935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG + Intergenic
936419589 2:112350474-112350496 CTGTGGACCAGTAAAGAGCAAGG - Intergenic
937311280 2:120904874-120904896 CTCTGGCCCAGCAGAGAGAAGGG + Intronic
937834934 2:126462341-126462363 CTGCTGCCCAGGAGAAAGGAAGG + Intergenic
938291705 2:130154185-130154207 CTGTGATCCAGCAGGAAGGAGGG - Intronic
938643884 2:133311379-133311401 CAGTGTGCCAGGAGAGAGCATGG - Intronic
939368428 2:141265349-141265371 CTGCAGTCCAGGAGACAGGCTGG - Intronic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
939948083 2:148434606-148434628 CTGTGGTCCAGGAGTGGGGTTGG + Intronic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
940005743 2:149008099-149008121 CTTCTTTCCAGGAGAGAGGAGGG - Intronic
940196760 2:151103672-151103694 CAGTGGTGCAGAAGAAAGGAAGG + Intergenic
941861511 2:170286159-170286181 GTGTGGTCCAGGTTTGAGGATGG + Intronic
942405493 2:175649423-175649445 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
942535782 2:176961895-176961917 GGGTGGCCCAGGAGGGAGGAGGG + Intergenic
945194414 2:207225011-207225033 ATGTGGTACAGCTGAGAGGAGGG - Intergenic
946195771 2:218032468-218032490 CTGTGGTCAAAGAGAGATGCTGG + Intergenic
946291512 2:218748978-218749000 GTGAGGCCCAGGAGAAAGGAGGG - Intronic
946455395 2:219821429-219821451 CAGTGGTTCAGGGGAGGGGATGG - Intergenic
946756370 2:222951823-222951845 CTGTGGTCCACTAGGGAGGTGGG + Intergenic
947524387 2:230869504-230869526 CTGAGGACCAGGAGAGATGTGGG + Intronic
947733739 2:232444469-232444491 CTCTGGCCCAGGAAGGAGGAGGG - Intergenic
947751450 2:232534885-232534907 CTGTGCTACAGCAGAGAGGGAGG + Intronic
948040693 2:234899316-234899338 GTGTGGTGCAGGACAGAGGGTGG - Intergenic
948285918 2:236785152-236785174 CAGTGATCCAAGAGAGAGCAAGG - Intergenic
948294166 2:236848301-236848323 CTATAGCCCAGGAGAGATGAGGG - Intergenic
948591668 2:239054385-239054407 CTCTGGTCCAGGGAAGAGGCCGG + Intronic
948788621 2:240365756-240365778 CTTTGCTCCAGGAGAGGGGTGGG - Intergenic
1169013502 20:2271956-2271978 CTGGGGCGCAGGAGAGGGGAGGG + Intergenic
1169015087 20:2285391-2285413 CTGTCTTCCAGTAGAGAGGGTGG + Intergenic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171067466 20:22032299-22032321 TTGTGGTCCAGGAGAGGTCATGG + Intergenic
1171468161 20:25347319-25347341 TTGCAGTCCAGGAGAGAGAAGGG - Intronic
1171489814 20:25508889-25508911 ATGTGCTTCAGGAAAGAGGAAGG - Intronic
1172438300 20:34946099-34946121 CTGTGATCAAGAAGAGAGAATGG + Intronic
1172661400 20:36571778-36571800 CCGTCCTCCAGGAGAGAGGAGGG + Intergenic
1172705508 20:36879396-36879418 CTGTGTGCCAGGTGAGAGGTGGG + Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1172778823 20:37423706-37423728 CTGTGCGCCAGGAGAGGGGCTGG - Intergenic
1173477613 20:43372862-43372884 CTTCGCTCCAGGAGAGAGCAAGG - Intergenic
1173561591 20:44009829-44009851 CTGTGGTGCAGGGGTGAGCATGG + Intronic
1173595378 20:44255767-44255789 CTCTGGTCCAGGGGAGAGGGAGG - Intronic
1173705555 20:45107925-45107947 CTGAGGTCTTGGAGAGGGGAAGG - Intergenic
1173712033 20:45166776-45166798 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1173741885 20:45407161-45407183 CTGTGCTCCAGCAGCGAGGAGGG - Intronic
1174146349 20:48455256-48455278 CTCTGGTCCTGGGCAGAGGAGGG - Intergenic
1174417470 20:50377007-50377029 CTGGCACCCAGGAGAGAGGAAGG - Intergenic
1175022728 20:55868112-55868134 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1175348118 20:58297614-58297636 CTGCTGTCCATGAGGGAGGAGGG - Intergenic
1175925503 20:62469399-62469421 CTCTGGTTCAGGGAAGAGGATGG - Intronic
1176411351 21:6451061-6451083 GTGAGGTCCAGGAGAGGGGCTGG - Intergenic
1177572670 21:22907495-22907517 AAGTGGTCAAGAAGAGAGGAAGG + Intergenic
1178525888 21:33328340-33328362 CTGAATTCCAGAAGAGAGGAGGG + Intronic
1179308160 21:40173683-40173705 CTGGGGTGGAGGGGAGAGGATGG - Intronic
1179686844 21:43059383-43059405 GTGAGGTCCAGGAGAGGGGCTGG - Intronic
1180071560 21:45439280-45439302 CCGTGGTCCAGGGGCGCGGAGGG + Intronic
1181041555 22:20194935-20194957 CTGGGGTCCATGACAGAAGAGGG - Intergenic
1181347834 22:22233256-22233278 CTGTGTTTCAGGAGAGAGCTTGG - Intergenic
1181508021 22:23374808-23374830 CAGTGGTCATGGATAGAGGAGGG - Intergenic
1181962189 22:26630187-26630209 CTGTGGTAGGGGAGAGAGCATGG + Intronic
1182032979 22:27174751-27174773 CTGCAGTCCAGCAGAGAGGAAGG + Intergenic
1182600039 22:31455281-31455303 GTTCTGTCCAGGAGAGAGGATGG + Exonic
1184067397 22:42128496-42128518 CTCTGGGCAAGGAGAGAGGGTGG - Intronic
1184257453 22:43295312-43295334 CTCTGGTCCAGGGCAGAGGAAGG - Intronic
1184598180 22:45526746-45526768 CTCTGGCCCAGGAGAGAGCTGGG + Intronic
1185049344 22:48545707-48545729 CTTGGGTGCAGGAGAGAGGGAGG + Intronic
1185056571 22:48581854-48581876 CTGTGTTCCTGGAGAGGGGAGGG + Intronic
1185159732 22:49216126-49216148 CTGTGGTCCAATGGAGGGGAGGG - Intergenic
1185161342 22:49231757-49231779 TTGGGTTCTAGGAGAGAGGAAGG - Intergenic
1185274008 22:49942154-49942176 CTGTGTCCCAGGAAAGAAGAGGG + Intergenic
949518178 3:4826021-4826043 CTTAGGTGCAGGAGAGAGGAAGG + Intronic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
949661401 3:6283429-6283451 CTCTGGGCCAGGAGAGAGTAGGG + Intergenic
949896510 3:8770814-8770836 CTGTCTTCCAGGAGAAAGAAGGG - Intronic
950038897 3:9906946-9906968 CTCGGGTCCTGGGGAGAGGAAGG - Exonic
950258949 3:11529937-11529959 CTCTTGCCCAGGAGACAGGAGGG + Intronic
951167248 3:19497589-19497611 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
951430002 3:22595791-22595813 GTGTGGGACAGGAGAGAGAAAGG + Intergenic
952219820 3:31313751-31313773 CTGTGGACCACAAGAGAGAATGG - Intergenic
952379720 3:32795361-32795383 CTGTGATCTAGGACAGAGCAGGG + Intergenic
953104916 3:39868138-39868160 CTGAGGTCCATCACAGAGGATGG + Intronic
953697343 3:45170329-45170351 CTGGGCTCCAAGAGAGAGAAAGG + Intergenic
954420507 3:50416578-50416600 CTGGGGCCCAGGACAGAGCAGGG - Intronic
954577339 3:51683917-51683939 CTCTTCTCCAGGAGATAGGAGGG + Intronic
954660932 3:52226437-52226459 CATGGGTCTAGGAGAGAGGATGG - Intergenic
954724229 3:52593775-52593797 CTGTGGTCTAAGAGAGTGGTTGG + Intronic
954947856 3:54442361-54442383 CTGTGCTCCAGGCCAAAGGAAGG - Intronic
955825402 3:62941068-62941090 TTATGTGCCAGGAGAGAGGAGGG - Intergenic
955938846 3:64128836-64128858 CTTTGGTGGAGGAGAGAGGGAGG - Intronic
956315865 3:67936071-67936093 TGGTTGTCCAGGAGAGATGAGGG + Intergenic
957073082 3:75580741-75580763 CTGTGGACCAGGAGTGGTGATGG + Intergenic
957365263 3:79214142-79214164 CTGTGTTCCAGGTGAGACCATGG + Intronic
958605825 3:96356959-96356981 CTGTGGTCCAAGAGTGTGGGTGG - Intergenic
958878511 3:99642590-99642612 TTGTTGTCCAGGAGGGACGATGG - Intronic
960428966 3:117545490-117545512 CAGAAGTCCTGGAGAGAGGAAGG + Intergenic
960708505 3:120504593-120504615 CTGAAGGGCAGGAGAGAGGAGGG - Intergenic
960968138 3:123119753-123119775 CTGTGTTTCAGCAGCGAGGAGGG - Intronic
961416825 3:126765312-126765334 CTTGGGTCCAGGTGAGAGGAGGG + Intronic
961653176 3:128427562-128427584 CTGTGGGCCATGAGGGAGGCTGG - Intergenic
962280487 3:134048492-134048514 CTGGGTTCCAGCAGAGACGAAGG - Intronic
962953616 3:140244047-140244069 CTGAGGTAAAGTAGAGAGGAAGG + Intronic
964069031 3:152609827-152609849 CTGTTGTCCAGGCTAGAGTAAGG - Intergenic
966432486 3:179846785-179846807 CTGAGGACCAGGAGAGCTGATGG - Intronic
967983451 3:195078877-195078899 CTGTGGTCAAGGTGAAGGGAAGG - Intronic
968485632 4:859697-859719 CTGACCTCCAGGAGAGAAGAGGG + Exonic
968530109 4:1086946-1086968 ATGGGGTCGGGGAGAGAGGATGG + Intronic
968680549 4:1915887-1915909 CTCTGTGCCAGGTGAGAGGAGGG - Intronic
969133562 4:5011376-5011398 CTGTTGTCCAGGTGGGAGGCTGG + Intergenic
969733572 4:8971827-8971849 CCATGATCCAGGAGAGAAGAGGG - Intergenic
969882273 4:10184794-10184816 CTGGGTTCCAGGAAACAGGAAGG - Intergenic
972083749 4:35186433-35186455 CTGTGGTCCAAGAAAGTGGTTGG - Intergenic
972083755 4:35186586-35186608 CTGTGGTCCAAGAAAGTGGTTGG - Intergenic
972201331 4:36717378-36717400 GTGGGGTCCAGAAGAGAAGAAGG - Intergenic
972948409 4:44286753-44286775 CTTTGCTCCTGGAAAGAGGATGG + Intronic
973540416 4:51929770-51929792 CTGAGGTCCAGGAGTGCTGAAGG + Intergenic
974623072 4:64385485-64385507 CTGTGTCCCAGGAAACAGGAGGG - Intronic
974746948 4:66089130-66089152 GTGTGGTCCAGAAGAGGAGAAGG - Intergenic
975114984 4:70670403-70670425 TGGTAGTCCAGGAAAGAGGATGG - Intronic
975264824 4:72350960-72350982 CTGAGAGCCTGGAGAGAGGAAGG - Intronic
975344705 4:73281026-73281048 CTGTGGTCCAGGAGTATGGTTGG + Intergenic
975369848 4:73572276-73572298 AAGTGGTCCAAGAGAGAGCAAGG + Intronic
976931250 4:90569772-90569794 TGCTGGTCCAGGAGAGAGCAGGG + Intronic
978082897 4:104616368-104616390 CTCTGCTTAAGGAGAGAGGAGGG - Intergenic
978369405 4:108015561-108015583 CTGTGGGGTAGGAGAGAGGGAGG - Intronic
978404723 4:108367098-108367120 CTGTAGACCAAGTGAGAGGATGG + Intergenic
978446693 4:108787228-108787250 CTTGGGTCCAGGTGAGAGCAGGG + Intergenic
978596486 4:110382572-110382594 CTGTGGTCCAAGAGAGTGGCTGG - Intronic
978886983 4:113775852-113775874 CTGTGGTCCCCCAGATAGGATGG - Intergenic
981162253 4:141512523-141512545 ATGTGGTCCAGGTCACAGGATGG - Intergenic
984770175 4:183430579-183430601 CTGTGGGACAGCAGAGAGAAGGG + Intergenic
985051359 4:185995518-185995540 CTGAGAACCAGGAGAGCGGATGG + Intergenic
985370677 4:189282514-189282536 CTGAGAACCAGGAGAGATGATGG + Intergenic
985543744 5:499031-499053 CTGGGGACCAAGAGAGGGGAAGG + Intronic
985744937 5:1641127-1641149 CCGGGATCCAGGAGAAAGGAAGG - Intergenic
985766878 5:1784765-1784787 CTGAGGACCAGGTGAGATGAAGG - Intergenic
986217698 5:5735863-5735885 CTGTGGTCCAAGAGCGTGGTTGG + Intergenic
986260976 5:6146039-6146061 CAGGGGTCCAGAAGAGAGGAAGG - Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
986909494 5:12536428-12536450 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
988306080 5:29496066-29496088 CTGTTGTCCAAGAGAGTGGTTGG + Intergenic
988967057 5:36429831-36429853 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
989716111 5:44465653-44465675 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
992093365 5:73339064-73339086 GTGTGGTGGAGGAGAGATGATGG + Intergenic
992284248 5:75217074-75217096 CTGTGGTCCAAGAGTGTGGGTGG + Intronic
993903677 5:93601322-93601344 CTTTTGTCAAGGAGAGTGGAGGG - Intergenic
994395961 5:99225995-99226017 CTAATGTCCAGGAGAGGGGAGGG - Intergenic
994642834 5:102431581-102431603 CTGGGGTCCAAGAGAGTGGTTGG + Intronic
995435468 5:112129984-112130006 CTGTGGGGCATGAGAGAGTAGGG - Intergenic
996018529 5:118567632-118567654 CTGGGGTCCAGAACAGAAGAAGG + Intergenic
996536352 5:124581748-124581770 CTGTGCTCCAGTGGGGAGGAGGG + Intergenic
996646909 5:125827920-125827942 CTGAGAACCAGGAGAGATGATGG + Intergenic
996767254 5:127046878-127046900 CTGTGAGCCAGGAGAGAACAAGG + Exonic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
997978994 5:138457548-138457570 CAATGGTCCAGGAGAGAGGGTGG - Intergenic
998446812 5:142204999-142205021 CTGGGGGCCAGGTGAGATGAGGG + Intergenic
998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG + Intergenic
998498732 5:142613892-142613914 CTGTAGTCAAGGTGGGAGGAAGG - Intronic
998935351 5:147227625-147227647 CTATGATCCAGGAGAGAAGAGGG - Intergenic
999283543 5:150380444-150380466 CTGAGGTCCTGGAGAGATGGAGG + Intronic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999550383 5:152680158-152680180 CTGTGGTGCTGGGGAGGGGAGGG - Intergenic
1000299842 5:159946140-159946162 CCGTGGTCCAGAAGAGATGATGG + Intronic
1000369218 5:160519030-160519052 CTGAGGTCCAGGGATGAGGATGG + Intergenic
1002284311 5:178152094-178152116 CTGTAGTCCTGGAGAGGTGATGG - Intronic
1002470613 5:179433159-179433181 CAGTGAGCCAGGAGAGAGGCCGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002899577 6:1399605-1399627 CTGGGGACCTGGAGAGAGAATGG - Intergenic
1003241008 6:4345819-4345841 AAGTGATCCAAGAGAGAGGAAGG + Intergenic
1003246039 6:4383002-4383024 CTGGTGTCCAGTAGAGAAGAGGG + Intergenic
1003347051 6:5279685-5279707 CTGAGAACCAGGAGAGTGGATGG + Intronic
1003712299 6:8605464-8605486 CTGGGTTCCAGCAGAGAGAAAGG - Intergenic
1004172126 6:13303318-13303340 CTCTTGGCCAGGAGAAAGGAAGG - Intronic
1004330539 6:14716738-14716760 CCGTGGTCAAGGAGAGACGTTGG - Intergenic
1004386643 6:15178799-15178821 CTGTGTTTTAGTAGAGAGGAGGG - Intergenic
1004458991 6:15818033-15818055 CTGATGTCCAGGAAAGAGAAGGG + Intergenic
1004883211 6:20028508-20028530 CTGTAGTCCAGGAGAAATGATGG - Intergenic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1005909983 6:30300920-30300942 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1006091413 6:31631256-31631278 CTGGGGGCCAGGGGAGTGGACGG - Exonic
1006576947 6:35053418-35053440 CTGTGGTCCAGAAGAGGGACAGG + Intronic
1006810938 6:36820098-36820120 CTCTTCTCCAAGAGAGAGGAGGG + Intronic
1006850188 6:37092752-37092774 CCCTGGTCCAGAAAAGAGGAGGG + Intergenic
1006977555 6:38117462-38117484 ATGTGGTCAAGAAGAGAGAAAGG - Intronic
1007321069 6:41028974-41028996 TTGTGGCCTAGGAGAGAGGGAGG - Intronic
1007354182 6:41299029-41299051 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1007409563 6:41653978-41654000 CTGGGGTGGAGGAGAGAGGCAGG - Exonic
1007641103 6:43340416-43340438 CTGTGGTCCTAGAGACAGAACGG - Exonic
1007896708 6:45369554-45369576 CTTTGGTGGAGGAGAGTGGAGGG - Intronic
1007913249 6:45536659-45536681 CACTGGTCCAGGAGAGATGCCGG - Intronic
1008366058 6:50681932-50681954 TAGTGGTTCAGGAGAGAGTAAGG - Intergenic
1010466143 6:76168434-76168456 CTGTGGTCCAAGAGTGTGGTCGG - Intergenic
1011786692 6:90854421-90854443 CTGTGGTCCAGGAGAGCAGGTGG + Intergenic
1012238549 6:96846190-96846212 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
1012510316 6:99993979-99994001 CTGCAGTCCCGCAGAGAGGAAGG - Exonic
1012586611 6:100931007-100931029 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1012668837 6:102014783-102014805 CTGTGGTCCCTGAGAGTGGTTGG + Intronic
1012834168 6:104243988-104244010 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1013972132 6:116033397-116033419 CAGTGGTTCAGGATAGAGCAAGG + Intronic
1015044867 6:128764958-128764980 CTGTGGTCCAAGAGTGTGGCTGG - Intergenic
1015510124 6:134030232-134030254 CTGTGGCCCAGGAGATAAGAGGG - Intronic
1016093160 6:140003542-140003564 CTGAGAACCAGGAGAGTGGATGG - Intergenic
1016277832 6:142375407-142375429 CTGTGTTTCAGGAGAAATGATGG + Intronic
1017484012 6:154886088-154886110 CAGTGGTCCAGGAGGCAGGAAGG + Intronic
1017676515 6:156819983-156820005 CTGTGGTGGAGAGGAGAGGAAGG + Intronic
1017813414 6:158000400-158000422 ATGTGGTCCAAGAAAGATGAAGG - Intronic
1017877936 6:158538934-158538956 CTGTGGTCAGAGAGAGAGGCTGG + Intronic
1017957923 6:159194445-159194467 CATTTGTCCAGCAGAGAGGATGG + Intronic
1018928867 6:168226435-168226457 ATGAGGTCCAGAAGAGAGGAGGG + Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019272130 7:156291-156313 CTGAGGTCCGGGTGAGAGGAGGG - Intergenic
1020425971 7:8066731-8066753 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1020638614 7:10727750-10727772 CTGAGGTCAAGGAGAGAGCTTGG - Intergenic
1021824484 7:24534963-24534985 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1022167650 7:27785800-27785822 GAGTGATCCAGGAGAGAGCAAGG + Intronic
1022838614 7:34140964-34140986 CCATGGGCCAGGAGAGAGGATGG + Intronic
1023138065 7:37073631-37073653 CTGTCGTCCAGGCTAGAGTACGG + Intronic
1024881549 7:54091401-54091423 CGGTGATCCAGGGGTGAGGATGG - Intergenic
1025198124 7:56947486-56947508 CTGTGGCCCAGGAGAGGTGGGGG - Intergenic
1025673825 7:63629451-63629473 CTGTGGCCCAGGAGAGGTGGGGG + Intergenic
1025849978 7:65237459-65237481 CAGGGGCCCAGGACAGAGGAGGG + Intergenic
1026203628 7:68236555-68236577 CTGAGATGCAGGAGAGAGGAGGG + Intergenic
1026445440 7:70480683-70480705 CTGTGTGGCAGGAGACAGGAAGG + Intronic
1026517096 7:71082388-71082410 CAGTGGTCCAGGAGAGATGATGG - Intergenic
1028049493 7:86164126-86164148 CTGTGTTCCAGGGAACAGGAAGG + Intergenic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1029251482 7:99239823-99239845 GTGTGGGCCAGCAGAGAGAAGGG - Intergenic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029422204 7:100477553-100477575 CTGAGGTCCAGGAGAGGTGGGGG + Exonic
1030108876 7:106009616-106009638 CTGTGCTCCCGCAGGGAGGAGGG + Intronic
1030873997 7:114791142-114791164 CTGTAGTCCAGTTGAGAGCATGG + Intergenic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032326806 7:130936517-130936539 TTGTGGTCCAGGAGGGAGGTGGG - Intergenic
1032501739 7:132404831-132404853 CTGTGGCCCAGGAGACCAGAAGG + Intronic
1033248368 7:139737558-139737580 CTGCAGTCCAGGAGAAAGGTGGG - Intronic
1033321333 7:140342440-140342462 CAGTGGTCAAAGAAAGAGGAAGG - Intronic
1033614603 7:143002129-143002151 CTGAGCTCCTGGTGAGAGGATGG - Intergenic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034451122 7:151137890-151137912 CTGTGGTCCGGGAGCGGGGCGGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1034826465 7:154269449-154269471 CTGTGGCCCAGGAGAAGGGCAGG - Intronic
1035132671 7:156669869-156669891 CTCTGTTCCAGGTGACAGGAGGG + Intronic
1038068405 8:23986900-23986922 CTGATGCACAGGAGAGAGGAGGG + Intergenic
1038431591 8:27504691-27504713 CTGTTGTCAAGGAGGAAGGAGGG + Intronic
1038859647 8:31373480-31373502 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1038869985 8:31483386-31483408 CTGAGGCCCAGGAGAGTGAAGGG + Intergenic
1038905463 8:31897254-31897276 CTGAGTTCCAGAAGGGAGGAGGG - Intronic
1040760417 8:50835027-50835049 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
1040977641 8:53212171-53212193 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
1041169769 8:55129628-55129650 CTGAGGACCAGAAGAGGGGATGG + Intronic
1041372342 8:57175208-57175230 CTGTGGTCCAAGAGAATGGCTGG - Intergenic
1042083170 8:65078048-65078070 CTTTGGTAGGGGAGAGAGGAGGG + Intergenic
1042112323 8:65393900-65393922 CTGAGATCCAGGAGAGTCGATGG + Intergenic
1042351647 8:67783354-67783376 CTGTTTTCCAGGAGAGACCACGG - Intergenic
1043566835 8:81558431-81558453 CTGTGGTGCAGGAAAGATGGAGG - Intergenic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1044184579 8:89236368-89236390 CTGTGGACCACTAAAGAGGAAGG - Intergenic
1044451647 8:92342642-92342664 CTGTGGGCCAGTTGAGAGGAGGG + Intergenic
1044649692 8:94481325-94481347 CTTTGGTGCAGCAGAGAGGAAGG - Intergenic
1044692430 8:94894599-94894621 CGCTGGTCCAGGAGGGAGGCGGG - Intronic
1045676320 8:104612058-104612080 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1046754929 8:117963105-117963127 CTGTGTTCCAGGGAACAGGAAGG - Intronic
1047788963 8:128182798-128182820 CTGTGTTTCAGCAGAGAGGGAGG + Intergenic
1047976013 8:130131522-130131544 CTGGGGTCGAGGTGGGAGGATGG + Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048518884 8:135135930-135135952 GAGTGGTGCAGGAGACAGGATGG - Intergenic
1048671068 8:136720887-136720909 CTGTGATATAGGTGAGAGGAGGG - Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1049778341 8:144416375-144416397 CTGGGGTCCTGGGGAGAAGAGGG + Intronic
1049831192 8:144701564-144701586 CTGTGGTCCAGGGCACAGGTTGG - Intergenic
1051110502 9:13629925-13629947 CTGTGGTCCAAGAGAGCGGTTGG - Intergenic
1051133596 9:13892150-13892172 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
1051634239 9:19167080-19167102 CTGGGGACTATGAGAGAGGAGGG - Intergenic
1051799472 9:20915776-20915798 TTGTGATGCAGCAGAGAGGAGGG + Intronic
1052051131 9:23850670-23850692 CCGTCCTCCAGGAGAGGGGAGGG + Intergenic
1052094379 9:24366921-24366943 CTGTGGTCTAAGAGAGCGGTTGG + Intergenic
1052739135 9:32376378-32376400 CTGGGGTACAGGGGAAAGGAAGG + Intergenic
1053548427 9:39048590-39048612 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1053812549 9:41868654-41868676 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1054618046 9:67318785-67318807 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1055782979 9:79840375-79840397 CTGTGGTCCAGGAGTGTGGTTGG + Intergenic
1055954434 9:81760995-81761017 GTGTGTTCCAGGAGCAAGGAGGG - Intergenic
1056762021 9:89422471-89422493 CTGAAGTCCAAGAGAGAGGCTGG + Intronic
1057878923 9:98778528-98778550 CTGGGCCCCAGGAGAGGGGAGGG - Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058575508 9:106396682-106396704 ATGAGGTCCAAGAGAGAGGCAGG + Intergenic
1058826993 9:108783894-108783916 CTTTGGTCCAGGAGAGGGATAGG - Intergenic
1059203819 9:112444794-112444816 CTGTGTTCCAGTGGAGAGTAGGG - Intronic
1059455058 9:114395097-114395119 CTGGGGTGCAGGAGGGAGGGAGG + Intergenic
1059705997 9:116823836-116823858 CTGAAGTCCATGATAGAGGAAGG - Intronic
1060634526 9:125189566-125189588 CGGGGGTCCTGGAGAAAGGAAGG + Exonic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061589255 9:131588196-131588218 GTGTCGTCCCGGAGAGAGGCAGG - Intronic
1061667836 9:132170615-132170637 CTGTGGTCCCCGTGAGAGGAAGG + Intronic
1061730674 9:132611522-132611544 CAGAGGTCCTGGGGAGAGGAAGG - Intronic
1062084482 9:134641740-134641762 CTGCCTTCCAGGAGAGAGGGAGG + Intergenic
1062279812 9:135746900-135746922 CTCTGGTCTAGGGGAGGGGAGGG + Intronic
1185521284 X:741717-741739 CTGAGGCCCAGGAGAGCCGAGGG - Intergenic
1185521347 X:742169-742191 CTGAGATCCAGGAGAGCTGAGGG - Intergenic
1185521407 X:742669-742691 CTGAGATCCAGGAGAGCTGAGGG - Intergenic
1185521467 X:743120-743142 CTGAGATCCAGGAGAGCTGAGGG - Intergenic
1185521489 X:743271-743293 CTGAGATCCAGGAGAGCTGAGGG - Intergenic
1185521529 X:743571-743593 CTGAGATCCAGGAGAGCTGAGGG - Intergenic
1185521551 X:743722-743744 CTGAGATCCAGGAGAGCTGAGGG - Intergenic
1185521580 X:743972-743994 CTGAGACCCAGGAGAGACGAGGG - Intergenic
1186982190 X:14969138-14969160 CTGTCGTGGGGGAGAGAGGAGGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189209339 X:39270739-39270761 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
1189384087 X:40522339-40522361 CTGTGGTACAGCAGAGAGGAGGG + Intergenic
1190412939 X:50154888-50154910 TTGTGGGCCAGTAGAAAGGAAGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191917971 X:66222594-66222616 CTGTGGACCACTAGAGAGCAAGG - Intronic
1192882185 X:75297606-75297628 CTGTTTTCCAGAAGAGAGGCAGG + Intronic
1192995578 X:76508828-76508850 CTGTGGTCCAATAGAGTGGGTGG + Intergenic
1193407678 X:81122201-81122223 CTGTGGTGCTGGCAAGAGGAGGG + Intronic
1193859787 X:86651213-86651235 TTGTGGGGCAGGAGAGAGGTGGG + Intronic
1194019671 X:88671189-88671211 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1194344645 X:92748540-92748562 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
1194540179 X:95159998-95160020 CTGTGGTCCAAGAGTGTGGATGG - Intergenic
1194935142 X:99939344-99939366 CTTGGGTCCGGGCGAGAGGAGGG + Intergenic
1195544191 X:106097129-106097151 CTGTGGTCCAAGAGAGTGGATGG + Intergenic
1195855626 X:109329354-109329376 CTGTGGTCCAAGACAGTGGTTGG + Intergenic
1196234085 X:113259239-113259261 CTGTGGTCCAAGAGCGTGGTTGG + Intergenic
1196375645 X:115029710-115029732 GAGAGGGCCAGGAGAGAGGAGGG - Intergenic
1196475077 X:116074346-116074368 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1197214340 X:123854120-123854142 TTGAGGTCCAAGAGAGAGGCTGG - Intergenic
1198178120 X:134175047-134175069 CTGTGGTCTGGGGGAGGGGACGG - Intergenic
1199063152 X:143383347-143383369 CTGTCGTCCAAGAGAGAGTTTGG + Intergenic
1199354415 X:146844691-146844713 CTGTGGTCCAAGAGCGTGGTTGG + Intergenic
1199382550 X:147187320-147187342 CTGTGGTACTGAAGAAAGGATGG - Intergenic
1199400409 X:147392229-147392251 CTGTGGTCCAAGAGCGTGGTTGG - Intergenic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1200652991 Y:5865178-5865200 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
1200834290 Y:7717922-7717944 CTGAGGTCCAGAAGAGGGAAGGG + Intergenic
1201621384 Y:15962441-15962463 CTGAGATCCAGGAGAGCTGAAGG - Intergenic