ID: 1005961801

View in Genome Browser
Species Human (GRCh38)
Location 6:30699020-30699042
Sequence TTGTATTTTTGGTAGAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005961801_1005961805 -7 Left 1005961801 6:30699020-30699042 CCTCGTCTCTACCAAAAATACAA No data
Right 1005961805 6:30699036-30699058 AATACAAAATTCATCGGGCATGG No data
1005961801_1005961810 27 Left 1005961801 6:30699020-30699042 CCTCGTCTCTACCAAAAATACAA No data
Right 1005961810 6:30699070-30699092 TATGGTCCCAGCTACTTGGGAGG No data
1005961801_1005961806 9 Left 1005961801 6:30699020-30699042 CCTCGTCTCTACCAAAAATACAA No data
Right 1005961806 6:30699052-30699074 GGCATGGTTGCACACACCTATGG No data
1005961801_1005961808 24 Left 1005961801 6:30699020-30699042 CCTCGTCTCTACCAAAAATACAA No data
Right 1005961808 6:30699067-30699089 ACCTATGGTCCCAGCTACTTGGG No data
1005961801_1005961807 23 Left 1005961801 6:30699020-30699042 CCTCGTCTCTACCAAAAATACAA No data
Right 1005961807 6:30699066-30699088 CACCTATGGTCCCAGCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005961801 Original CRISPR TTGTATTTTTGGTAGAGACG AGG (reversed) Intergenic