ID: 1005961803

View in Genome Browser
Species Human (GRCh38)
Location 6:30699031-30699053
Sequence CCCGATGAATTTTGTATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005961803_1005961806 -2 Left 1005961803 6:30699031-30699053 CCAAAAATACAAAATTCATCGGG No data
Right 1005961806 6:30699052-30699074 GGCATGGTTGCACACACCTATGG No data
1005961803_1005961807 12 Left 1005961803 6:30699031-30699053 CCAAAAATACAAAATTCATCGGG No data
Right 1005961807 6:30699066-30699088 CACCTATGGTCCCAGCTACTTGG No data
1005961803_1005961813 24 Left 1005961803 6:30699031-30699053 CCAAAAATACAAAATTCATCGGG No data
Right 1005961813 6:30699078-30699100 CAGCTACTTGGGAGGCTGAGAGG No data
1005961803_1005961810 16 Left 1005961803 6:30699031-30699053 CCAAAAATACAAAATTCATCGGG No data
Right 1005961810 6:30699070-30699092 TATGGTCCCAGCTACTTGGGAGG No data
1005961803_1005961808 13 Left 1005961803 6:30699031-30699053 CCAAAAATACAAAATTCATCGGG No data
Right 1005961808 6:30699067-30699089 ACCTATGGTCCCAGCTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005961803 Original CRISPR CCCGATGAATTTTGTATTTT TGG (reversed) Intergenic