ID: 1005961806

View in Genome Browser
Species Human (GRCh38)
Location 6:30699052-30699074
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005961801_1005961806 9 Left 1005961801 6:30699020-30699042 CCTCGTCTCTACCAAAAATACAA No data
Right 1005961806 6:30699052-30699074 GGCATGGTTGCACACACCTATGG No data
1005961803_1005961806 -2 Left 1005961803 6:30699031-30699053 CCAAAAATACAAAATTCATCGGG No data
Right 1005961806 6:30699052-30699074 GGCATGGTTGCACACACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005961806 Original CRISPR GGCATGGTTGCACACACCTA TGG Intergenic