ID: 1005963834

View in Genome Browser
Species Human (GRCh38)
Location 6:30712456-30712478
Sequence CACTGTCCCCAAAAGGAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005963828_1005963834 22 Left 1005963828 6:30712411-30712433 CCAGGTGGATCCCAGGTGAGCTC 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG 0: 1
1: 0
2: 0
3: 16
4: 156
1005963829_1005963834 12 Left 1005963829 6:30712421-30712443 CCCAGGTGAGCTCTTATCTGCTT 0: 1
1: 0
2: 3
3: 12
4: 248
Right 1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG 0: 1
1: 0
2: 0
3: 16
4: 156
1005963830_1005963834 11 Left 1005963830 6:30712422-30712444 CCAGGTGAGCTCTTATCTGCTTC 0: 1
1: 0
2: 2
3: 11
4: 174
Right 1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG 0: 1
1: 0
2: 0
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005963834 Original CRISPR CACTGTCCCCAAAAGGAGGT TGG Exonic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
901163134 1:7195640-7195662 CTCTGACCCCATGAGGAGGTTGG + Intronic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
903657483 1:24958195-24958217 CACTGACCTCAAAGGGTGGTTGG - Intronic
905059445 1:35126923-35126945 CTCTGTCTCCAAAAACAGGTTGG - Intergenic
907834073 1:58092743-58092765 CTCTGTCAGCAAAAAGAGGTGGG + Intronic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
909226602 1:73032475-73032497 CACTGTCCCCTAAAGGTGGCAGG - Intergenic
912546654 1:110456189-110456211 CACCTTCACCAAAGGGAGGTAGG - Intronic
912962434 1:114208119-114208141 CACTGTCCCTCAGAGGAGGGAGG - Intergenic
913201626 1:116499258-116499280 CACTGTCCCTAAAAGCAGCTCGG + Intergenic
913479926 1:119278228-119278250 CACTGTCCTGAGATGGAGGTAGG - Intergenic
916214983 1:162386443-162386465 CTCTGTCCACATAAGGAAGTTGG + Intronic
918005633 1:180539856-180539878 CACTGACAGCAAGAGGAGGTAGG + Intergenic
920399209 1:205666725-205666747 TACTGTCTCCAAAAGGAAGGTGG + Intronic
924365980 1:243294457-243294479 CACTCCCCCCAAAAGGTGGGGGG + Intronic
1063868060 10:10388635-10388657 CACTATACACCAAAGGAGGTAGG - Intergenic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1074399904 10:113133411-113133433 CTCTATCCTCAAAAGGAGGATGG - Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1079074908 11:17378642-17378664 CACTTTCCCCAACAGCAGTTGGG + Intergenic
1080801844 11:35617587-35617609 CCCTCTCCCCAACACGAGGTTGG + Intergenic
1081802289 11:45868270-45868292 AACTGTCCCCAGAAGGAGAGAGG + Intronic
1081951070 11:47043442-47043464 CACTGTACCCCTAAGGAGGTTGG - Intronic
1084179782 11:67440535-67440557 CACTGCCCCTAAATGCAGGTGGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084940362 11:72609370-72609392 CACTTTCCCCAGAAGGAAGGTGG + Intronic
1085297196 11:75437910-75437932 CCCTGTCCCCACCAGGAGGAGGG + Intronic
1090363782 11:126190162-126190184 CCCTGTCCCCAAATGGGGGCTGG - Intergenic
1094032778 12:26032272-26032294 CATTTTCCCCGAAAGGAAGTGGG + Intronic
1094332015 12:29304062-29304084 CACCTTCACCAAAACGAGGTTGG + Intronic
1097119268 12:56719129-56719151 CACTAACCCCTAAAGGAGATGGG + Intronic
1098974329 12:76886771-76886793 TTATGTCCCAAAAAGGAGGTGGG - Intergenic
1100739029 12:97570830-97570852 CACTGTCTGCATAAGGATGTGGG - Intergenic
1103480041 12:121244945-121244967 AGCTGTCAGCAAAAGGAGGTGGG + Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1106884445 13:34168921-34168943 CAATGTCCTCACAAGGAGGAAGG + Intergenic
1107129573 13:36880547-36880569 CACTGTCCTGAAAAGTAGTTTGG - Intronic
1110709194 13:78631372-78631394 CTCTGACCCCTAAAGAAGGTTGG - Intronic
1115081322 14:29454451-29454473 CATTGTCCCCAAAAGGATAAAGG + Intergenic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1120219149 14:81712981-81713003 CACTGGCCCCAAAAGTAGCAGGG - Intergenic
1120573363 14:86149491-86149513 CACTGTGCACAAAATGAGCTAGG - Intergenic
1120979199 14:90276008-90276030 CACTGTCCCAAACCCGAGGTGGG + Exonic
1121606784 14:95246445-95246467 CACAGTTCCCAAGAGGAGGGGGG - Intronic
1122740656 14:103869953-103869975 GAATGTCACGAAAAGGAGGTTGG - Intergenic
1123975866 15:25554008-25554030 CCCTGTCACCAAAAAAAGGTGGG + Intergenic
1126425938 15:48527059-48527081 CACTGGCCCCAGAAGGAATTGGG - Intronic
1127127192 15:55823148-55823170 CAATGTCCCCAGATGGAGATAGG + Intergenic
1127623851 15:60761009-60761031 CCCTGTGCCCAAAAGGAGAAGGG - Intronic
1131511437 15:93051468-93051490 CATCCTCCCCAAAAGCAGGTAGG + Intronic
1133619394 16:7512202-7512224 CACTGTCCCCTACATGAAGTTGG + Intronic
1137008126 16:35297352-35297374 CACTTTCCACAAAAGGAATTGGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1139137612 16:64223836-64223858 GAATGTCCCCAAAAATAGGTGGG - Intergenic
1140545578 16:75805715-75805737 TTCTTTCCCCAAGAGGAGGTGGG - Intergenic
1142129439 16:88426003-88426025 CTCTGTCCCCAGCACGAGGTTGG - Intergenic
1143543317 17:7582260-7582282 CAGTGGCCCCAAGAGGAGGAAGG - Intergenic
1144766895 17:17737977-17737999 CCCTGGCCCCAGAAGGAGGGAGG + Intronic
1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG + Intronic
1148743886 17:49907871-49907893 CACTGTGCCCAGAAGGAGAGAGG - Intergenic
1150601450 17:66654386-66654408 CATTTTTCCCAAAAGGTGGTTGG - Intronic
1151231747 17:72690065-72690087 CACGCTCCCCAGAAGGAGGAAGG - Intronic
1151472484 17:74326725-74326747 AACTGCCCCCAGAAGGAGGGTGG + Intronic
1152011761 17:77723327-77723349 CCCTGTCCCCAAAGGGAGTATGG + Intergenic
1152264983 17:79288915-79288937 CTCTGTCCCCAACAGGAGCCAGG - Intronic
1152422021 17:80198620-80198642 CACTGTCCCCATGAGGAGCCCGG - Intronic
1157431126 18:47627385-47627407 CACTGTCCCAGACAGAAGGTGGG - Intergenic
1161613331 19:5256437-5256459 AACTGTCCCCAAGAGGATGGAGG + Intronic
1163455952 19:17405754-17405776 CAGTTTCCCAGAAAGGAGGTGGG + Intronic
1164486985 19:28666929-28666951 TTTTGTCCCCATAAGGAGGTAGG + Intergenic
1164858755 19:31545822-31545844 CACTGGCCCCAAAAGAGGGCTGG - Intergenic
1164957934 19:32403217-32403239 CACTTTCCTCACAAGGAGGCAGG + Intergenic
1165252144 19:34547890-34547912 CTCTGTCCCCAAAAGAACATAGG + Intergenic
1168328245 19:55549757-55549779 CACTGTCCCCATCAGGAAATTGG - Intergenic
926019527 2:9482987-9483009 CACTGCCCCCCAAAGCAGTTAGG - Intronic
929136243 2:38626510-38626532 CACTGACATCAAAAGGATGTGGG - Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
936287069 2:111189123-111189145 CACTCCTCCCAAAAAGAGGTGGG - Intergenic
937019114 2:118634024-118634046 CGCTGGCCCCCAAAAGAGGTTGG + Intergenic
937260122 2:120580083-120580105 CGCTGTCCCCAGAGGAAGGTGGG + Intergenic
937674850 2:124578654-124578676 CTCAGTCCCCACAAGGAGCTGGG - Intronic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
942317782 2:174710663-174710685 AACTGTCCCCACAAGGAGGGGGG - Intergenic
942348446 2:175027989-175028011 CACTGGCCCCAAGAGGAGCCAGG + Intergenic
942690217 2:178577068-178577090 CACTGTCCACAAAAGTCGGCTGG + Exonic
943308566 2:186298254-186298276 CACTTTCCTCACAAGGAGGAAGG - Intergenic
943912556 2:193586997-193587019 CCCAATCCCCAACAGGAGGTTGG - Intergenic
944791687 2:203136798-203136820 TGCTGTCACCAAAAGGAGGATGG - Intronic
945283731 2:208061526-208061548 CAGGTTCCCCAAAAGGAGTTTGG - Intergenic
945964876 2:216175953-216175975 CACTGCCGCCAAGAGGAGGAAGG - Intronic
948762936 2:240203916-240203938 CACGGCCCCCAACAAGAGGTAGG - Intergenic
949062154 2:241967454-241967476 CACTGTCCCTAAAATGAAGCCGG + Intergenic
1170445677 20:16424843-16424865 CACTGTCAGAAAAAGGAGCTAGG + Intronic
1172214720 20:33227145-33227167 CACTGTCCCCCAAGAGAGCTGGG + Intronic
1173870647 20:46339888-46339910 CACTTTCCCCAAAAGCATTTTGG + Intergenic
1174502915 20:50998921-50998943 CACAGTTCCCAAGAGGAGGGTGG + Intergenic
1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG + Intergenic
1178271609 21:31194977-31194999 TACTGTCCTAAAAAGGAAGTGGG - Intronic
1179132823 21:38653782-38653804 CACTGTCCCAAACAAGAGGTGGG - Intronic
1179571142 21:42279548-42279570 CACTGCCCCAAAAGGCAGGTGGG - Intronic
1180189316 21:46155001-46155023 CACTGGACCCAAAACGAAGTAGG - Intronic
1180938674 22:19642430-19642452 ATCTGTTCCCAAAAGGAGGTGGG - Intergenic
1182719243 22:32384359-32384381 CACTGTCTCTAAAATGAGGAGGG + Intergenic
1183390980 22:37545694-37545716 CACCTAACCCAAAAGGAGGTAGG - Intergenic
1183458281 22:37934461-37934483 CTCTGTCCCCAGAACCAGGTTGG + Intronic
1184119059 22:42438503-42438525 CGCTGTCCCTACAAGGAGGAGGG - Intergenic
1185019731 22:48367140-48367162 CACTGTCCTCACATGGAGGAAGG + Intergenic
951472606 3:23072152-23072174 CCCTTTCCCCAAAACAAGGTAGG + Intergenic
952974807 3:38684711-38684733 CACTGTTACCAAAAGGAGGAAGG - Intergenic
953655645 3:44851257-44851279 CCCTGTCCCTAAAGGGGGGTGGG + Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
954764666 3:52903508-52903530 CAATGTCCACAAAAATAGGTTGG + Intergenic
955947418 3:64208845-64208867 CACTGTACCTAAAACAAGGTAGG - Intronic
956564742 3:70623828-70623850 TAATTTCCCCAAAAGGAAGTTGG - Intergenic
958712381 3:97732996-97733018 CACTGTCCCCACAGAGAGGCCGG + Intronic
961324871 3:126104092-126104114 CACTGTCCAGACAAGGCGGTGGG - Intronic
966114492 3:176445295-176445317 CACCTACCCCAAAAGGAGCTGGG + Intergenic
966378617 3:179322602-179322624 CTCTGTCCCCAACAGGCGGCTGG + Intergenic
972069028 4:34991552-34991574 CACTGTTCCCAATAGGGTGTAGG + Intergenic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
977761117 4:100738493-100738515 CACTCTCCCCAAAGGCAGGTTGG - Intronic
979343339 4:119555050-119555072 CACTGTCCCAAGAAGCAGCTGGG - Intronic
979963331 4:127047719-127047741 CACTGTACCCAACAAAAGGTAGG + Intergenic
980292270 4:130858773-130858795 AACTGTTCTCAAAAGGAAGTTGG - Intergenic
982140952 4:152317463-152317485 CACTCCCCCAAAAAGGAGCTGGG + Intergenic
982789922 4:159579000-159579022 CACTGTCCCTAAAAAAAGGAAGG - Intergenic
983860707 4:172702662-172702684 CACTGTCCTCACATGGAGGGAGG - Intronic
985615282 5:916394-916416 CACTGTCCCCAGCAGCCGGTTGG + Intronic
986014227 5:3743713-3743735 CACTGTCACCATAAAGAGGGGGG + Intergenic
986076728 5:4345380-4345402 CCCTGTCCTCAACAGGAGCTGGG - Intergenic
987373574 5:17215643-17215665 ATCTGGCCCCAAAAGGAGGTGGG + Intronic
996428816 5:123347363-123347385 CACTATCCCCAAAACGTGTTTGG - Intronic
996492086 5:124110031-124110053 AAGTCTCCCCAAAAGGATGTGGG + Intergenic
997127511 5:131243038-131243060 CACTGTCCCTAAAAGGACTAAGG - Intergenic
998052403 5:139046824-139046846 AACTGGCCCCAAAGGGAGGAAGG - Intronic
1000252219 5:159506471-159506493 CATTTTCCCCAAAAGAAGGGTGG - Intergenic
1000740879 5:164968837-164968859 CACTTTCCCCAACAGCAGTTGGG - Intergenic
1002713310 5:181208466-181208488 CACGGTAGCCAAAAGGAGGAAGG - Intergenic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1005963919 6:30713044-30713066 CACTGTCCTCTCCAGGAGGTTGG + Exonic
1007121120 6:39382322-39382344 CAGAGACTCCAAAAGGAGGTAGG - Intronic
1008448134 6:51617618-51617640 GGCTGTCCCTAAAAGGAGGTAGG - Exonic
1010015829 6:71104196-71104218 CACTAACCCCATTAGGAGGTGGG - Intergenic
1011723862 6:90188130-90188152 GACAGTCACCAAAAGGAGTTGGG - Intronic
1013376308 6:109518228-109518250 CCCTTTCTCCAAAAGGAGCTTGG + Intronic
1015829627 6:137354183-137354205 AACTGTCTTCAAAAGGAGGAGGG - Intergenic
1018543462 6:164909868-164909890 CACTTTCCACAAATGGATGTTGG - Intergenic
1024301783 7:47892538-47892560 ATCTGTCTCCAAAAGGAGGGAGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1029695921 7:102213181-102213203 CAATCTCCACCAAAGGAGGTGGG - Intronic
1035539128 8:418185-418207 CACTGTCCCCAAAACGCAGATGG - Intronic
1036651036 8:10644149-10644171 CCCTGTCCCCGAACGGAGCTTGG - Intronic
1037468454 8:19183962-19183984 CACAGACCCCAAAAGGAAGCAGG - Intergenic
1040489374 8:47905714-47905736 CACTGCTGCCAAAAGGAGGGAGG + Intronic
1042684421 8:71422291-71422313 TAATGTCTCCAAAAGGAGGAAGG - Intronic
1048901928 8:139047030-139047052 CCCTGTCTCCAAAAAGAGGAAGG - Intergenic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053152318 9:35750872-35750894 GACTGACCCCGAAAGGAGGGTGG - Exonic
1053368110 9:37538084-37538106 AGCTGTCCCCAAAAGGAACTGGG + Intronic
1056469799 9:86894289-86894311 CAGCGTTCCCAAAAGGAGCTGGG - Intergenic
1057164785 9:92916973-92916995 CACTTGCCCCAGGAGGAGGTGGG + Intergenic
1187409224 X:19034298-19034320 CTCTGTCCCCAAAACGTGTTTGG - Intronic
1187449870 X:19386896-19386918 GACTGTCCCCAAAAGGGCGTGGG + Intronic
1190284835 X:48955148-48955170 TCATGTCCCCAAAAGGAGTTGGG + Intronic
1190634140 X:52417880-52417902 CCCTGTTTCAAAAAGGAGGTTGG + Intergenic
1191924750 X:66297424-66297446 CAATCTCCCCAAAAGCAGTTGGG - Intergenic
1194010294 X:88553575-88553597 CACTGCCCCCAAATTGAGGAGGG - Intergenic
1194073996 X:89365299-89365321 TACTCTTCCCACAAGGAGGTGGG - Intergenic
1196373251 X:115001906-115001928 CACTATCACCAAAATGAGCTTGG + Intergenic
1200729385 Y:6716852-6716874 TACTGTTCCCACAAGGAGGTGGG - Intergenic