ID: 1005966569

View in Genome Browser
Species Human (GRCh38)
Location 6:30730860-30730882
Sequence GCCACCTAGGCACCCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005966569_1005966576 3 Left 1005966569 6:30730860-30730882 CCATCTTGGGGTGCCTAGGTGGC 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1005966576 6:30730886-30730908 TGAGCTAGGCAGGGTCAGGGAGG 0: 1
1: 0
2: 6
3: 26
4: 375
1005966569_1005966572 -7 Left 1005966569 6:30730860-30730882 CCATCTTGGGGTGCCTAGGTGGC 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1005966572 6:30730876-30730898 AGGTGGCAAGTGAGCTAGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 215
1005966569_1005966579 26 Left 1005966569 6:30730860-30730882 CCATCTTGGGGTGCCTAGGTGGC 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1005966579 6:30730909-30730931 GGACATTTACTTCTCTGCCTCGG 0: 1
1: 0
2: 2
3: 22
4: 226
1005966569_1005966577 4 Left 1005966569 6:30730860-30730882 CCATCTTGGGGTGCCTAGGTGGC 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1005966577 6:30730887-30730909 GAGCTAGGCAGGGTCAGGGAGGG 0: 1
1: 3
2: 4
3: 72
4: 734
1005966569_1005966575 0 Left 1005966569 6:30730860-30730882 CCATCTTGGGGTGCCTAGGTGGC 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1005966575 6:30730883-30730905 AAGTGAGCTAGGCAGGGTCAGGG 0: 1
1: 0
2: 0
3: 22
4: 359
1005966569_1005966578 5 Left 1005966569 6:30730860-30730882 CCATCTTGGGGTGCCTAGGTGGC 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1005966578 6:30730888-30730910 AGCTAGGCAGGGTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 48
4: 564
1005966569_1005966574 -1 Left 1005966569 6:30730860-30730882 CCATCTTGGGGTGCCTAGGTGGC 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1005966574 6:30730882-30730904 CAAGTGAGCTAGGCAGGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 232
1005966569_1005966573 -6 Left 1005966569 6:30730860-30730882 CCATCTTGGGGTGCCTAGGTGGC 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1005966573 6:30730877-30730899 GGTGGCAAGTGAGCTAGGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005966569 Original CRISPR GCCACCTAGGCACCCCAAGA TGG (reversed) Intronic
900398585 1:2463539-2463561 GAAACCGAGGCACCCCACGAAGG + Intronic
900728976 1:4239257-4239279 CCCACCTTGGCCCCCCAAAATGG + Intergenic
911503803 1:98723605-98723627 CCCACCTAGGCCTCCCAAAACGG - Intronic
921040808 1:211429952-211429974 GTCACCTAGGCTGCCCAGGATGG - Intergenic
923200843 1:231709951-231709973 GCCTCCTAGCCACTCTAAGAGGG - Intronic
924811067 1:247402584-247402606 GACACATAAGCACCCCAAGTAGG + Intergenic
1063693832 10:8313498-8313520 GCCACCTGCTCACCCCCAGATGG + Intergenic
1064124226 10:12645572-12645594 GCCATCTTGTGACCCCAAGAAGG - Intronic
1075610278 10:123848731-123848753 TCCTCCTATGCACTCCAAGAAGG + Intronic
1076437392 10:130455357-130455379 GGAACCTAGGGACCTCAAGAGGG - Intergenic
1077216174 11:1396068-1396090 GCCACCTCGGCAGCCAACGATGG - Intronic
1078840537 11:15073001-15073023 GCAACCTGGGCACCCAAAGAAGG - Intronic
1080666585 11:34341714-34341736 GTCTCCTGGGCACCACAAGATGG + Intronic
1082106000 11:48222573-48222595 GCCACCTTGGCACCTCAATGGGG - Intergenic
1083294636 11:61708712-61708734 TCCTCCCAGCCACCCCAAGAGGG + Intronic
1088258422 11:107922783-107922805 GTCACCCAGGCACCCCAGGTTGG - Intronic
1089050277 11:115539690-115539712 GCCATCGAGTCTCCCCAAGATGG + Intergenic
1091180342 11:133598966-133598988 GCCACCTGAGCACAACAAGAGGG + Intergenic
1091486245 12:891699-891721 CCCTCATAGGCACCCCAAAAGGG - Intronic
1104878020 12:132050052-132050074 GCCCCATAATCACCCCAAGAGGG - Intronic
1107070790 13:36266372-36266394 GCCACCTCTGCACACCCAGAGGG + Intronic
1107542193 13:41401463-41401485 CCCAGGCAGGCACCCCAAGAAGG - Intergenic
1115397667 14:32927085-32927107 TCCTCATAGGCACCCCAAAAGGG - Intergenic
1122553892 14:102566161-102566183 TCCACCTAGGCCCCTCAAGTAGG + Intergenic
1125679530 15:41522296-41522318 GCCACCTGGGGAGCCCTAGAAGG - Intronic
1126773760 15:52082254-52082276 GGCACCTGGGCATCTCAAGATGG - Intergenic
1131318721 15:91366133-91366155 GCCTCCTAGCCAGCCCTAGAAGG - Intergenic
1134180807 16:12046268-12046290 TGCACCTGGTCACCCCAAGAGGG - Intronic
1135914529 16:26593758-26593780 TCTACTTAAGCACCCCAAGAGGG - Intergenic
1136498985 16:30660188-30660210 GCAACCTGGTCACCCCTAGAGGG + Intronic
1140911548 16:79457771-79457793 GTGATCAAGGCACCCCAAGAAGG + Intergenic
1145125151 17:20293846-20293868 GCCACCTGCTCACCCCAACAAGG - Intronic
1146656760 17:34639091-34639113 GCCACCTATGCCCCACAAGACGG + Exonic
1149160498 17:53687178-53687200 GCACCCTTGGCACCCCAGGAAGG - Intergenic
1150500268 17:65643900-65643922 CCCTCCTAGGTACCCCAAGCTGG - Intronic
1152457333 17:80423882-80423904 GCCACCGTGGCACACCAAGTAGG + Intronic
1152608076 17:81302967-81302989 GCCATCTAGGCTCCCACAGAGGG + Intergenic
1154401647 18:14043703-14043725 GCCATCTTGGAACCTCAAGAGGG + Intergenic
1156396918 18:36707234-36707256 CCCTCCTGGGCATCCCAAGAGGG - Intronic
1160003739 18:75052755-75052777 GCCGCACAGGCACCCCCAGAAGG - Intronic
1160525605 18:79533729-79533751 CCCACCTTGGCATCCCCAGAAGG + Intergenic
1160996345 19:1883822-1883844 GCCCCCAGGACACCCCAAGAGGG - Intronic
1161240557 19:3220910-3220932 GCCTCCTGGCCACCCCCAGATGG - Intergenic
1161799876 19:6411703-6411725 CCCACCTAGGAACCCGAACAAGG - Intergenic
1163638832 19:18450393-18450415 GCCCCCTCGACACCCCATGAGGG + Intronic
1164541191 19:29122604-29122626 CCCACCTATGCTCCCCAGGAAGG - Intergenic
1164615327 19:29664071-29664093 TCCACCTGGGCACCCTGAGAGGG - Intergenic
925121207 2:1419785-1419807 GCCCCCTGAGCGCCCCAAGATGG - Intronic
927324281 2:21785165-21785187 ACCACCTAGCTAGCCCAAGAGGG + Intergenic
930314973 2:49786327-49786349 GCCACCTAGGCCTCTCAATAGGG + Intergenic
932887877 2:75563289-75563311 GACCCGTAGGAACCCCAAGAGGG - Intronic
934147379 2:89108720-89108742 CCCATCTCGGCGCCCCAAGATGG + Intergenic
934221893 2:90091872-90091894 CCCATCTCGGCGCCCCAAGATGG - Intergenic
934663021 2:96153213-96153235 GCCACCCAGACACCCAGAGAGGG + Intergenic
934735130 2:96686182-96686204 CCCACCTCGGCAGCCCCAGATGG + Intergenic
942801837 2:179884303-179884325 GCCACCTCAGCACCCCCATAAGG + Intergenic
943619036 2:190127010-190127032 GCCACCAGAGCACCCAAAGAGGG + Intronic
946158846 2:217823813-217823835 GGCACCTCGGCACCCAAAGCTGG + Intronic
948613749 2:239185254-239185276 GACACCGAGGCACCCCTATAGGG - Intronic
1173411403 20:42813534-42813556 GTCACCTAGGCAGAACAAGAAGG - Intronic
1175056638 20:56204661-56204683 GACACAAAGGCAGCCCAAGAAGG + Intergenic
1181824253 22:25501484-25501506 GCCACCTAGTCACTACCAGAAGG + Intergenic
1183380986 22:37490462-37490484 CCCTCCTCGGCCCCCCAAGAGGG + Exonic
1183713942 22:39522732-39522754 GCCACCCACCCACCCCAAGCTGG + Intergenic
1185004029 22:48264857-48264879 GCCTCCAGGGCACCCCAAAAGGG + Intergenic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
949410365 3:3756863-3756885 GCCTGCTAGGCAGCCCGAGAAGG + Intronic
949582918 3:5408987-5409009 GGCATTTATGCACCCCAAGAAGG + Intergenic
950057707 3:10040519-10040541 ATCACCTAGGAACCCAAAGAAGG - Intronic
950423901 3:12914473-12914495 GCAACCTAAGCACCCCAGGCTGG - Intronic
950662463 3:14475006-14475028 GCCATCCAGGCTACCCAAGAGGG + Intronic
953367567 3:42359191-42359213 GGTACCTAGGCAGCACAAGAGGG - Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
957070980 3:75567660-75567682 GCCACTAAAGCAGCCCAAGAGGG + Intergenic
968289314 3:197526462-197526484 TCCACAGAAGCACCCCAAGAAGG - Intronic
972875826 4:43358616-43358638 GACACCCAGCCACCACAAGATGG + Intergenic
975176175 4:71291666-71291688 CCCTCATAGGCACCCCAAAAGGG + Intronic
981289772 4:143060876-143060898 CCCACCTTGGCCTCCCAAGAGGG - Intergenic
982207566 4:153008269-153008291 CCCACCTTGGCCTCCCAAGATGG - Intergenic
983269550 4:165545291-165545313 GCCACTTGTGAACCCCAAGAAGG + Intergenic
985634371 5:1028677-1028699 GGCGCCTAGGCACCCCAAACCGG + Intronic
987655919 5:20805860-20805882 CCCACCTTGGCATCCCAAAATGG + Intergenic
988019012 5:25599049-25599071 CCCACCTCGGCCTCCCAAGATGG + Intergenic
988540516 5:32104474-32104496 GCCTCCTAAGCAGCCCAAGGTGG + Intronic
991144505 5:63284847-63284869 GCCACCTAGTTTCCCAAAGAAGG - Intergenic
992139238 5:73779649-73779671 GCCACATAAGCACCCAAGGATGG - Intronic
994970349 5:106730034-106730056 GCCAACTAGTCACAGCAAGAAGG + Intergenic
997346533 5:133196302-133196324 CCCACCCAGGCAGCCCCAGACGG - Intergenic
999890061 5:155967834-155967856 GCCACAGAGACACCTCAAGAAGG + Intronic
1002539094 5:179894248-179894270 GCCACCTTAGCGGCCCAAGATGG - Intronic
1005966569 6:30730860-30730882 GCCACCTAGGCACCCCAAGATGG - Intronic
1008569606 6:52803642-52803664 GTCACCCAAGCACACCAAGACGG + Intronic
1012522813 6:100140874-100140896 GACAGCAAGGCAACCCAAGAAGG + Intergenic
1018124177 6:160665952-160665974 GCCACCGGGACACCCCAGGAGGG + Intergenic
1018702888 6:166441477-166441499 GCCACCTCTGTTCCCCAAGACGG + Intronic
1019282924 7:209622-209644 GACACCTGGCCACCCCAGGAAGG + Intronic
1020119404 7:5494777-5494799 GCCACCTAGTGACCACACGACGG - Intronic
1020243835 7:6415590-6415612 GCCACCTTGGCCTCCCAAAATGG - Intronic
1023659419 7:42457212-42457234 GCCACCCAGTCACCCCAATCTGG - Intergenic
1024989833 7:55224434-55224456 GCCACCTCTGCACCCCAGGTGGG + Intronic
1028367244 7:90048201-90048223 GCCACCTAGGCAATCCCAGTAGG - Intergenic
1029509034 7:100981758-100981780 GCCACTGAGGGACCCAAAGAAGG - Intronic
1032471179 7:132180501-132180523 GCCACCAAGGCTTTCCAAGAGGG - Intronic
1047381368 8:124366998-124367020 CCCACCTAGGCCCGGCAAGAGGG - Intronic
1051396752 9:16630983-16631005 CCCACCTAGGCTTCCCAAGGTGG + Intronic
1057274482 9:93669135-93669157 GCCGTCTGGGCAACCCAAGAGGG - Intronic
1060060251 9:120453494-120453516 GCCACCCAGGCACCCCGTGCAGG + Exonic
1060221224 9:121765072-121765094 GCCAAATGGGCACCTCAAGATGG + Intronic
1062566631 9:137166596-137166618 GCCACCAGGGTGCCCCAAGAGGG + Intronic
1186464541 X:9774633-9774655 GCTACCTAGAGACCCCAGGATGG - Intronic
1189519408 X:41750414-41750436 GCCCCAGAAGCACCCCAAGATGG - Intronic
1190365893 X:49694941-49694963 GCCACTTATGCTCCCCAAGCTGG + Intronic
1191254325 X:58273281-58273303 TCAACTTAGGCACCCCAAGGTGG - Intergenic
1193981119 X:88182857-88182879 GCAAGCTATGCATCCCAAGATGG - Intergenic
1196137060 X:112221558-112221580 GCCACCTTAGCAACCCTAGAAGG + Intergenic