ID: 1005968007

View in Genome Browser
Species Human (GRCh38)
Location 6:30741347-30741369
Sequence AGGGGTAGGAAAGGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 418}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005967992_1005968007 24 Left 1005967992 6:30741300-30741322 CCAACATCTCCTTGTTCTGCCCC 0: 1
1: 0
2: 2
3: 32
4: 349
Right 1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG 0: 1
1: 0
2: 1
3: 61
4: 418
1005967995_1005968007 5 Left 1005967995 6:30741319-30741341 CCCCTGGATTTTTACCTGTAGCC 0: 1
1: 0
2: 1
3: 15
4: 104
Right 1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG 0: 1
1: 0
2: 1
3: 61
4: 418
1005967996_1005968007 4 Left 1005967996 6:30741320-30741342 CCCTGGATTTTTACCTGTAGCCA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG 0: 1
1: 0
2: 1
3: 61
4: 418
1005967991_1005968007 27 Left 1005967991 6:30741297-30741319 CCGCCAACATCTCCTTGTTCTGC 0: 1
1: 1
2: 2
3: 21
4: 294
Right 1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG 0: 1
1: 0
2: 1
3: 61
4: 418
1005968001_1005968007 -9 Left 1005968001 6:30741333-30741355 CCTGTAGCCAGAGTAGGGGTAGG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG 0: 1
1: 0
2: 1
3: 61
4: 418
1005967994_1005968007 15 Left 1005967994 6:30741309-30741331 CCTTGTTCTGCCCCTGGATTTTT 0: 1
1: 0
2: 3
3: 36
4: 318
Right 1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG 0: 1
1: 0
2: 1
3: 61
4: 418
1005967997_1005968007 3 Left 1005967997 6:30741321-30741343 CCTGGATTTTTACCTGTAGCCAG 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG 0: 1
1: 0
2: 1
3: 61
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005968007 Original CRISPR AGGGGTAGGAAAGGTGTGGT GGG Intronic
900390460 1:2431746-2431768 AGGGGTAGGAACGGAGAGGCAGG - Intronic
901262755 1:7885804-7885826 AGAGCCAGGAAAGGTGAGGTGGG + Intergenic
902205630 1:14866211-14866233 AGGGGTTGGACAGGTGATGTGGG - Intronic
902490551 1:16777880-16777902 AGGGGAAGGGAAGGGCTGGTGGG + Intronic
902694203 1:18129334-18129356 AGAGGCAGGAAAGGAGTGCTGGG + Intronic
906187505 1:43872238-43872260 AGAGGGAGGAGAGGTGTGGGGGG + Intronic
906192078 1:43905150-43905172 AGGGGGAGGAGAAGAGTGGTGGG - Intronic
906802555 1:48750460-48750482 TGGGGTAGGAGAGTTGTGGGTGG - Intronic
907080866 1:51620505-51620527 AGGGTTAGGAAAGGTTTCCTTGG + Intronic
907316517 1:53576071-53576093 ACGGGTAGGAAAGGGGCGGTGGG - Intronic
907364576 1:53947244-53947266 AGGGGCAGGAGAGCTGGGGTGGG + Intronic
907499464 1:54867664-54867686 AGGGGTAGGAAAGCTGAGGAGGG - Intronic
907706195 1:56834793-56834815 AGGTGGAGGACAGGTGTGGAGGG - Intergenic
907917245 1:58882371-58882393 ACGGTTATGGAAGGTGTGGTGGG + Intergenic
908168451 1:61481797-61481819 CGGGGGAGGAAGAGTGTGGTGGG + Intergenic
908704267 1:66933795-66933817 ATAGGTGGGAAAGGTTTGGTGGG + Intronic
909030059 1:70528989-70529011 AGTGGTGGGAAATGTGGGGTTGG - Intergenic
910733698 1:90427873-90427895 GGAGGTAGGAAAGGAGGGGTTGG + Intergenic
910874287 1:91863419-91863441 TGTGGTAGGAAATGTATGGTAGG + Intronic
911509783 1:98797286-98797308 AGGGGTTGAGAAGATGTGGTAGG + Intergenic
912374570 1:109199791-109199813 AGGGGTGGGGAAGATCTGGTTGG - Intronic
913251270 1:116913455-116913477 TGGGGGAGGAAAGGTGGGTTTGG + Intronic
914774767 1:150726542-150726564 AGGGGTGGGGAAGGTGTGTGAGG + Intergenic
915105570 1:153533371-153533393 AGGGGGAGGAAAGGGGTGTAGGG + Intergenic
915134520 1:153721396-153721418 TGGGGTTGGCCAGGTGTGGTGGG - Intergenic
915430148 1:155860116-155860138 TGGGGGAGGAGAGGTGGGGTAGG + Intronic
916910442 1:169340558-169340580 AGGGGTTGGAAAAGTTTGGAAGG + Intronic
918080527 1:181204496-181204518 AGGGATAGGAAAGCAGTGTTGGG + Intergenic
918093216 1:181315094-181315116 AGTTGTAGGCAAGATGTGGTTGG - Intergenic
918318725 1:183345126-183345148 AGGGGGAGACAAGGTGGGGTGGG - Intronic
919131527 1:193456784-193456806 AGGGGTAGGAAAGGGTTACTTGG + Intergenic
919352995 1:196483706-196483728 AGTGGCAGGAAAGGTGTGATGGG - Intronic
919509884 1:198448616-198448638 AGGGGTACAAAAGATGAGGTTGG + Intergenic
919539571 1:198830415-198830437 CAGGGGAGGAAAGGTTTGGTTGG + Intergenic
919823015 1:201484679-201484701 AGGAGTGGGCAGGGTGTGGTGGG + Exonic
920074518 1:203326765-203326787 AGGGGTAGAAAATGTGTGAGGGG + Intergenic
920342525 1:205284464-205284486 AGGTTTAGGAAGGGTGCGGTGGG + Intergenic
920511769 1:206557180-206557202 AGGGGCAGGAAAGGCGCGGGAGG + Intronic
920519373 1:206612277-206612299 AGGGGTCGGACAGGTGAGGGAGG - Exonic
921080283 1:211733554-211733576 TGGGGTGGGAAAGCTATGGTGGG - Intergenic
921394090 1:214650337-214650359 AGGGGTAGGAAGGGTATGGAGGG + Intronic
922648675 1:227318356-227318378 AGGGAGAGGAAGGGAGTGGTTGG - Exonic
923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG + Intergenic
923518295 1:234716024-234716046 AGGAGTAAGAAAGGAGTGGCTGG + Intergenic
923999413 1:239533925-239533947 CAGGGCAGGAGAGGTGTGGTAGG - Intronic
1063541437 10:6938110-6938132 GGGGGTAGGAGAGTTGTGGGGGG + Intergenic
1064389999 10:14933990-14934012 AGGGGGAGGAAAGGTGAGCTGGG + Intronic
1064400434 10:15016518-15016540 AGGGGGAGGAAAGGTGAGCTGGG + Intergenic
1066122957 10:32309133-32309155 AGGGGTAGAAAAAGTGGGGATGG + Intronic
1066384725 10:34932483-34932505 ACAGGTAGGCCAGGTGTGGTGGG - Intergenic
1066752474 10:38672622-38672644 AGAGGTAGGAAATGTGTGGAAGG - Intergenic
1066964556 10:42250415-42250437 AGAGGTAGGAAATGTGTGGAAGG + Intergenic
1067474481 10:46556793-46556815 AGGGGTCGGGAAGGAGGGGTGGG - Intergenic
1069663466 10:70139239-70139261 AGGGGTAGAACATGTCTGGTTGG - Exonic
1069703347 10:70441732-70441754 AGAGGGAGGAAAGGTGGGGGCGG - Intronic
1071230559 10:83580554-83580576 AGGGGTAGGGCAGCTGTGCTGGG + Intergenic
1071461684 10:85902898-85902920 AGGAGGAGGACAGGTGTTGTGGG - Intronic
1071969415 10:90887906-90887928 AGGGTTAGGAAAGTTCTGATTGG + Intronic
1073171283 10:101510980-101511002 AGGGGCTGGAAAGGTGGGGAGGG - Intronic
1074351804 10:112744888-112744910 AGGGGTAGAACAGGTTTTGTGGG + Intronic
1075835037 10:125445665-125445687 AGGGGTAGGGAAGGCTGGGTGGG - Intergenic
1076151858 10:128168962-128168984 AGGGGGAGCAAAGGTGGGGAAGG + Intergenic
1076715214 10:132360538-132360560 AGGGATAGGAAAAGGTTGGTGGG + Intronic
1077607537 11:3622167-3622189 AGGGGTGTGAAAGGTGGGCTGGG + Intergenic
1078083868 11:8222132-8222154 TGGGGTAGGCAAGGTGGGGCTGG + Intergenic
1078456216 11:11477502-11477524 AGGGAGAGGAAAGGTGTGGAGGG - Intronic
1078770045 11:14340802-14340824 AGGGGTAGGTAAGAGGTGGAAGG - Intronic
1079445974 11:20556504-20556526 AGAGGTAGGAAAAGTTTGGAGGG - Intergenic
1079882625 11:25945213-25945235 AGGGGTAGGGCAGCTGTGCTGGG - Intergenic
1080047166 11:27821267-27821289 AGGGCTGGGAACGCTGTGGTGGG + Intergenic
1080240332 11:30120273-30120295 AGAGGGAGTAGAGGTGTGGTGGG - Intergenic
1080618592 11:33967694-33967716 TGGGGAAGGGATGGTGTGGTAGG - Intergenic
1081650681 11:44822082-44822104 ACAGGCAGGAAAGGTGGGGTGGG + Intronic
1082858279 11:57828899-57828921 AGGGTGAGGCAAGGTGGGGTTGG - Intergenic
1083200427 11:61118150-61118172 GGGGGTCAGAAAGGTGTGGTGGG - Intronic
1083622232 11:64054969-64054991 GGCGGTAGGAAAGGGCTGGTAGG - Intronic
1083714804 11:64569087-64569109 TGGGGCAGGGAAGGAGTGGTGGG - Intronic
1084488209 11:69463466-69463488 AGAGGGAGGAAGGGTGTGTTTGG - Intergenic
1085649777 11:78257214-78257236 ATGAGCAGGAAAGGGGTGGTTGG + Intronic
1086332786 11:85770577-85770599 AGGGGTAGGAATGGTCCTGTAGG - Intronic
1086976141 11:93135359-93135381 AGGGATAGGAAGGGTGTGCTGGG - Intergenic
1087492615 11:98847289-98847311 TGGGGTGGGTGAGGTGTGGTGGG - Intergenic
1087866463 11:103233552-103233574 GGGGTGAGGAAGGGTGTGGTTGG + Intronic
1087910921 11:103752535-103752557 ATATGTAGGAAAGGTGTGGTAGG + Intergenic
1088619310 11:111665348-111665370 TGGGGTAGGAGGTGTGTGGTGGG + Intronic
1088922856 11:114274047-114274069 AGGGGTAGGAGGGGAGTGTTAGG - Intronic
1089105173 11:115996989-115997011 AGGGGAAGGAAAGCTGCTGTGGG + Intergenic
1089169623 11:116503004-116503026 AGGGCTAGGAAATGGTTGGTAGG - Intergenic
1089529303 11:119116298-119116320 AGGGGTATGGAAGGGGAGGTGGG - Exonic
1090790637 11:130090702-130090724 AGGGGCAGGAAAGGTGGGGAAGG - Intronic
1091087088 11:132731906-132731928 AGAGGTATGAAAGGTGAGGTTGG + Intronic
1091488779 12:915217-915239 AGGGGCAGGAAAGGCCTGGAGGG + Intronic
1092721307 12:11443733-11443755 AGGGGTAGGCAAGATGAGTTTGG + Intronic
1092974434 12:13730649-13730671 AGGTGTAGGAAAAATTTGGTGGG - Intronic
1093039495 12:14362145-14362167 GGTGGTATGAAGGGTGTGGTAGG - Intergenic
1095769057 12:45931075-45931097 GGGGGTGGGGTAGGTGTGGTGGG - Intronic
1096085859 12:48864746-48864768 AGGGGTGGGAAAGGGGTATTTGG + Intronic
1096109916 12:49022489-49022511 AGCAGGAGGAAAGCTGTGGTGGG - Intronic
1096122434 12:49097035-49097057 AGGGGAAGGAAAAGGATGGTGGG + Exonic
1096220515 12:49825986-49826008 GGGGCTGGGAAAGGTGGGGTGGG + Intronic
1096594641 12:52686937-52686959 AGGGAAAGGAGAGCTGTGGTTGG + Intergenic
1096648980 12:53052784-53052806 AGGAGGAGGAAGGGTGGGGTGGG + Intronic
1096750404 12:53755340-53755362 TGTGGTAGGAAATGTGTTGTTGG + Intergenic
1097633053 12:62087632-62087654 AGGGATAGGTAAGATGTGGTAGG + Intronic
1099476271 12:83110979-83111001 ATGGGAAGGGAAGGTGTGGGAGG - Intronic
1099490111 12:83278323-83278345 AAGGTTAGGCAAGGTGAGGTGGG + Intergenic
1099903833 12:88747820-88747842 AGGGTTAGGGAATATGTGGTAGG - Intergenic
1100023782 12:90102751-90102773 AAGGGTAGGCAAAGTGTAGTAGG + Intergenic
1100143189 12:91643956-91643978 AAGGGTAGGAGAGGTTTGGAGGG + Intergenic
1100954561 12:99892710-99892732 TGGAGTAGGAGAGGGGTGGTTGG - Intronic
1101160027 12:101964113-101964135 AGGGGTAGCCAAGGTGTCCTTGG + Intronic
1101734302 12:107451661-107451683 GGGGGAAGGAAAGGTGGGGGTGG - Intronic
1102018174 12:109662286-109662308 AGTGGTAGTAATGGGGTGGTAGG - Intergenic
1102394170 12:112573967-112573989 GGGGGAGGGAGAGGTGTGGTGGG + Intronic
1102514839 12:113439570-113439592 AAGGGTAGGAAAGGGTAGGTGGG + Intergenic
1102760139 12:115377628-115377650 AGAGGTTGGAAAGGTGGGGTGGG - Intergenic
1104922533 12:132298598-132298620 AGGGATGGGTTAGGTGTGGTGGG - Intronic
1104922548 12:132298671-132298693 AGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922565 12:132298747-132298769 GGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922645 12:132299133-132299155 GGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922653 12:132299153-132299175 AGGGGTGGGTTAGGTGTGTTGGG - Intronic
1104922697 12:132299374-132299396 AGGGATGGGTTAGGTGTGGTGGG - Intronic
1104922713 12:132299447-132299469 AGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922743 12:132299596-132299618 AGGGATGGGTTAGGTGTGGTGGG - Intronic
1104922757 12:132299669-132299691 AGGGATGGGTTAGGTGTGGTGGG - Intronic
1104922773 12:132299745-132299767 AGGGATGGGTTAGGTGTGGTGGG - Intronic
1104922789 12:132299818-132299840 AGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922806 12:132299891-132299913 AGGGATGGGTTAGGTGTGGTGGG - Intronic
1104922822 12:132299967-132299989 AGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922839 12:132300043-132300065 AGGGATGGGTTAGGTGTGGTGGG - Intronic
1104922855 12:132300119-132300141 AGGGATGGGTTAGGTGTGGTGGG - Intronic
1104922883 12:132300268-132300290 AGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922913 12:132300414-132300436 AGGGGTGCGTTAGGTGTGGTGGG - Intronic
1104922942 12:132300560-132300582 AGGGGTGCGTTAGGTGTGGTGGG - Intronic
1104922957 12:132300636-132300658 AGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922987 12:132300785-132300807 GGGGGTGGGTTAGGTGTGGTGGG - Intronic
1104922995 12:132300805-132300827 AGGGGTGGGTTAGGTGTGGTGGG - Intronic
1106057584 13:26253407-26253429 ATGGATAGGAAAGGTTTGGATGG + Intergenic
1107311946 13:39088397-39088419 AGAGGTAGGAATGGTAAGGTTGG + Intergenic
1108341613 13:49503238-49503260 AGAGGAGGGAAAGGTGGGGTGGG - Intronic
1112442681 13:99435590-99435612 AGGGGGAGGAAAGGGATGGAAGG - Intergenic
1113037883 13:106071042-106071064 AGGGGTTGGAGAGGTGGGGTAGG - Intergenic
1113427287 13:110219060-110219082 AGGGGTGGGAAAGCTGCGGTGGG + Intronic
1113627196 13:111856070-111856092 AGGGGGATGGAAGGTGAGGTGGG + Intergenic
1118313318 14:64708415-64708437 AGGGGTAGGGAAAGTGAGGGAGG + Intronic
1119410061 14:74424990-74425012 GGGGGTAGGGAAGTTGTGTTGGG + Intronic
1119880235 14:78093902-78093924 AGGGGCAGGTGAGGTTTGGTTGG + Intergenic
1119881918 14:78106418-78106440 AGGGAGAGGGAAGATGTGGTTGG + Intergenic
1120091488 14:80337353-80337375 AGAGGTAGGAAAGTTTTGCTTGG + Intronic
1120106463 14:80501264-80501286 AGGAGTAGAAAGGATGTGGTAGG + Intronic
1120145599 14:80975504-80975526 AGAGGCAGGGAAGGAGTGGTAGG - Intronic
1120453305 14:84699047-84699069 AAGGGTAGGGAACTTGTGGTGGG + Intergenic
1120514687 14:85456871-85456893 AGGAGCAGGAGAGGTGGGGTTGG - Intergenic
1120568219 14:86085670-86085692 AGGGGCAGACAAGGTGTGGGGGG + Intergenic
1121341844 14:93110082-93110104 AGGGGTAGGGAATGTGTCGAGGG + Intronic
1122476865 14:102016211-102016233 GGGGCTAGGAAAGGTGCAGTGGG + Intronic
1124822264 15:33058041-33058063 TGGTGGTGGAAAGGTGTGGTGGG + Intronic
1126065121 15:44820523-44820545 AGGGGAAGGCAAGTTGGGGTTGG + Intergenic
1126094708 15:45080060-45080082 AGGGGAAGGCAAGTTGGGGTTGG - Intergenic
1126098884 15:45107921-45107943 GGGGTTGGGAAGGGTGTGGTGGG + Intronic
1126107688 15:45157521-45157543 AGGGGTTCGAAAGGTGTGGCCGG + Intronic
1126249089 15:46545508-46545530 ATGTGTTGGTAAGGTGTGGTGGG + Intergenic
1126464712 15:48951234-48951256 GGGGGTAGGAAGGATGTGGCTGG - Intronic
1126965922 15:54053768-54053790 GGGGGTAGGAAAGGGGATGTGGG - Intronic
1128215254 15:65930254-65930276 AAGGGGAGAAATGGTGTGGTAGG - Intronic
1128255284 15:66191583-66191605 AGAGGAAGGCAAGATGTGGTGGG + Intronic
1128329656 15:66747297-66747319 TGGGGAAGGGCAGGTGTGGTGGG - Intronic
1128701935 15:69811093-69811115 AGGGGAAGGAAGGGTGAGATGGG - Intergenic
1128706946 15:69843405-69843427 AGGGGAAGGAAGGGTGTTCTTGG + Intergenic
1129032458 15:72629004-72629026 AGGGGAGGGAGAGGTGTGCTGGG + Intergenic
1129217432 15:74108235-74108257 AGGGGAGGGAGAGGTGTGCTGGG - Intronic
1129230177 15:74192685-74192707 AGGGGAAGGAAAGGCTTGATGGG - Intronic
1129734596 15:77952532-77952554 AGGGGAGGGAGAGGTGTGCTGGG - Intergenic
1129840994 15:78743459-78743481 AGGGGAGGGAGAGGTGTGCTGGG + Intergenic
1130095136 15:80850175-80850197 AGGGGTCGGAGAGGTGTCTTTGG + Intronic
1130564110 15:84980490-84980512 CGCGCTAGGAAAGGTGTGGACGG + Exonic
1132603700 16:784905-784927 AGAGCTAGGAAAGGTCTGGGTGG + Intergenic
1132702615 16:1228541-1228563 CGGGGCAGGGAAGGTGTGGGGGG + Exonic
1132705712 16:1242327-1242349 CGGGGCAGGGAAGGTGTGGGGGG - Exonic
1133212826 16:4272620-4272642 AGTGGTAGGAAGGGGGTGGGGGG + Intronic
1133804346 16:9112795-9112817 AGGGGTAGAAAAGATGAGGATGG - Intronic
1133900295 16:9967740-9967762 AGGGGTAGGGAAAGTTTGGGAGG + Intronic
1134241991 16:12513173-12513195 AGAGGGAGGAAAGGTATGGGAGG - Intronic
1135960976 16:26994280-26994302 CGGGGTAGGAAAGCTATGCTAGG + Intergenic
1136006605 16:27334713-27334735 AGGGGCGGGAATGGGGTGGTGGG - Intronic
1136572702 16:31106112-31106134 ACGGGTGGGAATGGTGTGGGTGG + Exonic
1136730247 16:32404408-32404430 AGAGGTAGGAAATGTGTGGAAGG + Intergenic
1137476171 16:48811475-48811497 AGGGGAAGGAAAGGAGAGGGAGG - Intergenic
1139188551 16:64835683-64835705 AGGGTCAGGATAGATGTGGTGGG - Intergenic
1141155481 16:81593954-81593976 AGGAGGAGGAAAGGTATGGTAGG - Intronic
1141420574 16:83912746-83912768 AGGGGGAGGACAGGCGTGGCAGG - Intronic
1142403640 16:89873957-89873979 AGGGGTGGGAAGGGTGACGTGGG + Intronic
1202996154 16_KI270728v1_random:112900-112922 AGAGGTAGGAAATGTGTGGAAGG - Intergenic
1203022841 16_KI270728v1_random:425242-425264 AGAGGTAGGAAATGTGTGGAAGG - Intergenic
1143348291 17:6266661-6266683 AGGGGTGGGCAAGGTGTGGGAGG - Intergenic
1143356692 17:6334887-6334909 AGGGGAAGGGAAGGGGTGGATGG + Intergenic
1143456081 17:7068831-7068853 AGAGGTTGGAAAAGTGTGGAGGG - Intergenic
1143805634 17:9424102-9424124 AGGGGTGGGAAAAATATGGTTGG - Intronic
1145867027 17:28248019-28248041 AGGGTTTGAAAAGGTGTGGTGGG + Intergenic
1146299175 17:31674853-31674875 GGGAGTAGGAAAGGTGTTTTAGG - Intergenic
1147049972 17:37786887-37786909 AGGGGTAGGAAGGGTGTACCAGG + Intergenic
1147925063 17:43941052-43941074 AGGGCTTGGAAAGGTGTAGTGGG - Intronic
1148200459 17:45746749-45746771 AGGGGTAGGAAAGGAGGAGAAGG - Intergenic
1148392070 17:47279919-47279941 AGGGGTAGGAGAGGTGGGCAGGG + Intronic
1148533342 17:48416350-48416372 AGGGATAGAAAAGGTTTGTTGGG + Intronic
1148759172 17:49990640-49990662 AGGAGTAGAGAAGGTGAGGTGGG + Exonic
1149251226 17:54771925-54771947 AGAGCTAGGAAAGGACTGGTAGG - Intergenic
1149308563 17:55372512-55372534 AGAGGTTGGAATGGTTTGGTGGG + Intergenic
1149409891 17:56394570-56394592 AGGGGTAGGGATGGTGGGGATGG - Intronic
1150243781 17:63658305-63658327 AGGGAAAGGCAAGGTGTTGTGGG - Intronic
1151439195 17:74117275-74117297 AGGGGTCCGAAAGGAGTGGTCGG - Intergenic
1151514386 17:74582794-74582816 AGGGGTAGGGAGGGTGAGATTGG - Intronic
1151824640 17:76517519-76517541 AGGGGTAGGAGGGGTGGGGGTGG - Intergenic
1151983589 17:77528421-77528443 AGGGGGAGGGAAGGTGAGGAGGG - Intergenic
1152003440 17:77662009-77662031 AGGGGTAGGGAAGGAGTGAGAGG + Intergenic
1153229725 18:2924325-2924347 AGGGGCAGGCAGTGTGTGGTGGG - Intronic
1153248046 18:3092973-3092995 AGAGGAAGGAAAAGTGTTGTTGG - Intronic
1153550732 18:6258969-6258991 TAGGGTAAGAAAGGAGTGGTTGG + Intronic
1154022845 18:10680120-10680142 TGGGGGAGGGAGGGTGTGGTGGG - Intronic
1155174422 18:23290187-23290209 AGGGGCATGAAACGTGTGGGAGG - Intronic
1155654881 18:28180802-28180824 GGGGGTAGGGAAGGGGAGGTGGG - Intergenic
1156020004 18:32588923-32588945 AAGGCTAGGAAAGGCGGGGTGGG + Intergenic
1157556804 18:48618116-48618138 AGGGCAAGGAATGGTGTGCTGGG - Intronic
1158018634 18:52814183-52814205 AGGGCTAGGAGAGGTATGGCAGG - Intronic
1158613429 18:58963881-58963903 ATGTGTATGAAATGTGTGGTAGG + Intronic
1158625023 18:59063460-59063482 AGAGGTAGGAACTGTGTGCTTGG + Intergenic
1159158802 18:64618059-64618081 AACGGTATGAATGGTGTGGTTGG + Intergenic
1159931398 18:74316020-74316042 AGGGGGAGGAAAGGGCGGGTGGG - Exonic
1160465060 18:79069385-79069407 AGGGGCGGGAAAGGGGCGGTCGG + Exonic
1161977352 19:7613785-7613807 AGGGCCAGGAAAGGGGTGGTAGG - Intronic
1162249509 19:9430470-9430492 AGGGGCAAGAGTGGTGTGGTTGG - Intronic
1162700407 19:12510914-12510936 AGGGGTCATAAAGGTGGGGTTGG - Intronic
1162828735 19:13270747-13270769 TGGGGTGGGGAGGGTGTGGTAGG + Intronic
1163253330 19:16139851-16139873 AGAGGAAGGAAGGGTGTGGAGGG - Intronic
1164732185 19:30514666-30514688 AGGGGCAGGTATGGTGGGGTAGG - Intronic
1166051405 19:40262911-40262933 AGAGGTGGGCAAGGTGAGGTGGG - Intronic
1166677406 19:44748461-44748483 AGGGAGAGGAAAGGAGGGGTGGG - Intronic
1167497142 19:49826374-49826396 AGGGCTGGGAAGTGTGTGGTGGG + Intronic
1168463861 19:56586200-56586222 AGGGGAAGGAATGCTGCGGTGGG + Intronic
1168522034 19:57059166-57059188 AGGGGTAGAAAAGATGAGGCAGG - Intergenic
925151052 2:1615120-1615142 AGGGGAGGGCAAGGTGGGGTGGG + Intergenic
925294658 2:2768986-2769008 AGGGGGAGGGGAGGTGTGGAGGG - Intergenic
925436456 2:3842427-3842449 AGGGTGAGGAAGGGGGTGGTGGG + Intronic
926321690 2:11752792-11752814 GGGGTTAGGAAAGCTGTGGCAGG + Intronic
926970927 2:18466595-18466617 AAAGTTAGGAAAGATGTGGTAGG - Intergenic
927205991 2:20610948-20610970 ATGGGCAGGACAGGAGTGGTTGG - Intronic
927281822 2:21315421-21315443 AGGGGTAGGAAGAGGGTGGGGGG + Intergenic
927430587 2:23023409-23023431 AGGGGGAGGCAAGGTGTGGCTGG - Intergenic
928920785 2:36525012-36525034 AGGGGGAGGGAAGTTGTGGAGGG - Intronic
929278593 2:40052872-40052894 AGGGGCAGAAAAGGAGTGCTAGG + Intergenic
929326526 2:40618243-40618265 AGTGGAAGTAAGGGTGTGGTAGG + Intergenic
932776471 2:74530830-74530852 TGGGGTAGGCCAGGTCTGGTTGG + Intronic
933645621 2:84810610-84810632 AGGGGAAGGGAAGGTGAGGCTGG - Intronic
934186550 2:89682462-89682484 AGAGCTAGGAAATGTGTGGAAGG + Intergenic
934315467 2:91914768-91914790 AGAGGTAGGAAATGTGTGGAAGG - Intergenic
934562466 2:95320410-95320432 AGGAGGAGGCAGGGTGTGGTGGG + Intronic
934656995 2:96121610-96121632 AGGGGAAAGCAAGGTGTGTTGGG - Intergenic
935017994 2:99202286-99202308 TGGGGTGGAAAAAGTGTGGTGGG - Intronic
935949539 2:108316323-108316345 AGGAGAGGGAAAGGTGTGGCTGG - Intergenic
936435624 2:112502800-112502822 TGGGGTAGGTAAGGAGTGGGAGG - Intronic
937030878 2:118739267-118739289 AGGGGCAGGAATGGTGAAGTGGG - Intergenic
937111399 2:119369218-119369240 AGGGGAAGGAAAGGTGAAGTGGG + Intronic
939718314 2:145614212-145614234 AGGAGTATGGAAGGTGTGTTGGG + Intergenic
939996519 2:148925754-148925776 AGGGCTAGGAATGGTGTGGGAGG + Intronic
940641815 2:156352792-156352814 GGGGAAAGGAAAAGTGTGGTTGG - Intergenic
941970207 2:171341932-171341954 AGGGAGAGGAAAGGAGTGGCTGG + Intronic
942044649 2:172093089-172093111 GGGGGTAGGAAAGCGGTGGGTGG - Intergenic
944218463 2:197278754-197278776 AGAGAAAGGAAAGGGGTGGTGGG - Intronic
944676403 2:202036381-202036403 TGGGGTGGGAAAGGTGGGGAGGG - Exonic
945128162 2:206536432-206536454 AGGGGTGGGAGTGGGGTGGTGGG + Intronic
945294259 2:208155327-208155349 AGGGGAAGGGAAGGTGTTCTAGG - Intergenic
946070382 2:217029769-217029791 AGGGGAAGAAAAGTGGTGGTGGG + Intergenic
946304364 2:218847133-218847155 AGGGGCGGGAAAGGTGGGGAAGG + Intergenic
946409564 2:219509327-219509349 AGGGGGTGGAAAGGGGTGGGTGG + Intergenic
946878897 2:224158195-224158217 CGGGTGAGGAAAGGTGTGGTAGG - Intergenic
946917196 2:224535984-224536006 TGGGGAAGGGAAGGTGTAGTAGG - Intronic
947537004 2:230946208-230946230 AGGGCTAGGGAGGGTGTGGAAGG + Intronic
947740156 2:232481244-232481266 AAGGGAAGGAGAGGGGTGGTAGG - Intronic
1170190180 20:13638255-13638277 AGGGGAAGGAAAGGTGTGTTAGG - Intronic
1170205118 20:13789832-13789854 AGGGTGAGGAAGGGAGTGGTGGG + Intronic
1170524218 20:17221476-17221498 AGGGGTGGGAGAAGTGTGGGAGG + Intergenic
1172192642 20:33071191-33071213 GGGGGTGGGACAGGGGTGGTTGG + Intronic
1172407331 20:34699561-34699583 TGGGGAAGGAAAGGAGTGGTGGG + Intronic
1172459576 20:35106969-35106991 AGGGGTAGGAGAGGGGTGTGTGG + Intergenic
1172778291 20:37420627-37420649 AGGGGCTGGCAAGGTGGGGTAGG - Intergenic
1173307358 20:41863090-41863112 CGGAGTAGGAAAGGGGTGGAGGG - Intergenic
1173678874 20:44862002-44862024 AGGGGGAGGAAAGGAGGGGGGGG + Intergenic
1174710803 20:52703060-52703082 AGGGTGAGGAGAGGTGGGGTGGG - Intergenic
1175023127 20:55872718-55872740 AGGGAAAGGAAAGCTGTGGGTGG - Intergenic
1175834513 20:61984970-61984992 AGGGGGAGGACGGATGTGGTGGG + Intronic
1176069523 20:63218819-63218841 AGGGGCAGGACAGGTCTGGTTGG + Intergenic
1176071026 20:63226550-63226572 AGGAGGAGGAAAGGGGTGGGAGG - Intergenic
1176071036 20:63226574-63226596 AGGAGGAGGAAAGGGGTGGGAGG - Intergenic
1177348202 21:19900471-19900493 AGGGGCAGGAAAGCTGGGCTGGG - Intergenic
1177946122 21:27471706-27471728 AGAGGTAGGAAAGTTGTTATTGG - Intergenic
1180233159 21:46440081-46440103 AGAGGTCGGAAAGGTCTGCTTGG + Exonic
1180542238 22:16460653-16460675 AGAGGTAGGAAATGTGTGGAAGG - Intergenic
1181582151 22:23834369-23834391 AGGGGTAGGGAGGGTGGGGTGGG - Exonic
1181737266 22:24891935-24891957 AGGGGCAGGAAGGGCATGGTGGG + Intronic
1182445372 22:30386783-30386805 AGAGGGAGGTAGGGTGTGGTGGG + Intronic
1182548894 22:31090658-31090680 AGGGGATGGAGAGGTGGGGTGGG + Intronic
1182599652 22:31451168-31451190 ATGTGTAGGCAGGGTGTGGTGGG - Intronic
1182830252 22:33299294-33299316 AAGGGAAGGAAAGGAGTGGAGGG + Intronic
1182879976 22:33724913-33724935 AAAGGAAGGAAAGGTGGGGTGGG + Intronic
1182959396 22:34457939-34457961 ATGGAGATGAAAGGTGTGGTTGG + Intergenic
1183058068 22:35319095-35319117 AGGGTGAGGGAAGGAGTGGTGGG + Intronic
1183316292 22:37138832-37138854 AGGGATAGGCAAGGTGGGTTTGG + Intronic
1183350050 22:37329931-37329953 AAGGGGAGGTAGGGTGTGGTTGG + Intergenic
1183692948 22:39401316-39401338 AGGAGTAGTAAAGGTGTGGAGGG - Intronic
1183720870 22:39560598-39560620 AGGGGTTGGAAAGGAGAAGTGGG - Intergenic
1184036978 22:41922933-41922955 AGGTGTGGGAGAGGTTTGGTGGG - Intergenic
1184259906 22:43308762-43308784 AGGGGTAGAAAAGGAGGAGTAGG - Intronic
1184644402 22:45888459-45888481 AGGGGCAGGGGAGGTGTGTTGGG - Intergenic
951340838 3:21484710-21484732 AGGAGAGGGAGAGGTGTGGTAGG + Intronic
953030699 3:39177964-39177986 GGGGGTGGGAAGGGGGTGGTGGG + Intergenic
954432940 3:50480897-50480919 AGGGGGAGGAAAGGGGAGGAAGG + Intronic
954714719 3:52521331-52521353 TGGGGTAGGAGAAGTGAGGTGGG - Intronic
955217536 3:56997038-56997060 AGGGGTAGGTGAGGTGGGGAGGG - Intronic
956334332 3:68146405-68146427 AGGAGGAGGAAAGTTTTGGTGGG - Intronic
957438436 3:80210564-80210586 AGAGGTAGAAAATGTGTGGTAGG - Intergenic
957509304 3:81167256-81167278 AGGGATGTGAAGGGTGTGGTGGG - Intergenic
957843239 3:85698580-85698602 AGGAGAAGGAGAGGTGGGGTGGG + Intronic
957945569 3:87058388-87058410 AGAGGTTGGAAAGGTTTGGAGGG - Intergenic
959031914 3:101309192-101309214 AGAGGTTGGAAAGGTTTGGAGGG - Intronic
960993779 3:123328263-123328285 AGGGGTGAGGAAGGTGGGGTGGG - Intronic
961100002 3:124190642-124190664 ATGGGTGGGAAAGGTGTATTAGG + Intronic
962273925 3:133998188-133998210 TGGAGGAGGAAATGTGTGGTGGG - Intronic
962484712 3:135831184-135831206 AGGGGTAGGGAAGGGATGGTAGG - Intergenic
963242845 3:143026925-143026947 AGGGGATGGAAAGGTGAGGGAGG - Intronic
964154164 3:153564453-153564475 ATGGAGAGGAAATGTGTGGTTGG + Intergenic
964755139 3:160085686-160085708 AGGGTTAGGCCAGGTGTGGATGG - Intergenic
964756117 3:160092155-160092177 AGGGATAGGCCAGGTGTGGAAGG - Intergenic
965634895 3:170770887-170770909 AGGGGCAGGAAAGGGAGGGTGGG + Intronic
965896680 3:173585480-173585502 AGGGGTAGGAAGAGAGGGGTGGG - Intronic
966226102 3:177599714-177599736 AGAGGAAGGAAGGGTGGGGTTGG + Intergenic
966431002 3:179831633-179831655 AGGGGGAGGAAAGGTGCTCTGGG + Intronic
966443544 3:179974799-179974821 AGGGGTAGGAAACAGGAGGTAGG - Intronic
966458935 3:180152925-180152947 AGGGAGAGGAAAGGTGTGATAGG + Intergenic
966684374 3:182678130-182678152 AGGGGTAGGATAGGTATGAAAGG + Intergenic
966692968 3:182760463-182760485 AGGGGGAAAAAAGGTGTGTTTGG - Intergenic
967888199 3:194347213-194347235 AGGGATAGGGAAGGTTTGGCTGG + Intronic
968380007 4:85437-85459 GGGAGGAGGAAAGCTGTGGTGGG + Intronic
969454692 4:7294630-7294652 AGGGGGAGGAAAGGTGAACTAGG - Intronic
970311233 4:14784532-14784554 AAGGCTAGCAGAGGTGTGGTTGG - Intergenic
970512358 4:16793942-16793964 AGGGGTAGGAAAGGAGCTGCAGG - Intronic
971473220 4:27049518-27049540 AGGGATGGGAATGTTGTGGTTGG + Intergenic
972407688 4:38762358-38762380 GGGGGTTGGAAAGGAGAGGTGGG + Intergenic
972948873 4:44293490-44293512 AGAGGTAGCAAAGGTGTAATTGG + Intronic
974102888 4:57437143-57437165 TGGGGTAGGGGAGGTGTGGCCGG + Intergenic
975696085 4:77014410-77014432 AGGGGTCTAAAAGGAGTGGTTGG + Intronic
980000786 4:127485177-127485199 AGTGGTAGGAAAGGCAAGGTTGG - Intergenic
980433938 4:132743655-132743677 AGGGATAGGAATGGAGTGGGTGG + Intergenic
981049642 4:140297533-140297555 AGAGGAAGGAAAGGTGTGGGAGG - Intronic
982242355 4:153313134-153313156 GGGAGCAGGAAAGGAGTGGTTGG - Intronic
983040020 4:162914421-162914443 AGGGATGGGACAGGTGTGCTGGG - Intergenic
983320541 4:166191081-166191103 AGGGGTTGGAAAAGTTTGGAGGG + Intergenic
985161460 4:187048798-187048820 AGGGGCAGGAGATGTGTGATAGG - Intergenic
985749613 5:1666941-1666963 AGGGGTAGGCAGGGTGGGGCAGG + Intergenic
987534637 5:19167831-19167853 AGGCCTGGGAAAGGTGAGGTTGG + Intergenic
987929261 5:24382559-24382581 AAGACTAGGAAAGGTGAGGTAGG - Intergenic
988515221 5:31898691-31898713 AGAGCTAGGAAAGGTTTGGCTGG - Intronic
989629690 5:43468503-43468525 AGGGTTAGTAAAAGTGAGGTTGG + Intronic
992686683 5:79206187-79206209 AGAGGAAGGGAGGGTGTGGTTGG + Intronic
994164644 5:96596041-96596063 AGGTGTAGGAATAGTATGGTAGG + Intronic
996159481 5:120145212-120145234 AGGGAGGGGAAAGGTGGGGTCGG - Intergenic
996429971 5:123363245-123363267 AGGAGTTGGAAAGGTGTCATAGG - Intronic
997066936 5:130571805-130571827 AGGGGTAGCAAAGGAGGGGAGGG - Intergenic
997189962 5:131922699-131922721 AGAGGTAGGAAAGGTGGGGATGG - Intronic
997215153 5:132103847-132103869 AGGGGTGGGGTAGGTGAGGTAGG + Intergenic
998210376 5:140192648-140192670 AGGGGAAGGGAAGGTTCGGTGGG + Intronic
1001400245 5:171442097-171442119 AGGGGTTGGTGAGGTGTGGGTGG - Intronic
1001581466 5:172801503-172801525 AGGGGTAGAATTGGTGCGGTGGG - Intergenic
1001654117 5:173336374-173336396 AGGGGTGGGAAAGGTGTTATAGG - Intergenic
1001827041 5:174753333-174753355 AGTGGTAGGAAGCGTGTGATAGG - Intergenic
1001980797 5:176035904-176035926 AGGGGTAGGGAGGGGCTGGTGGG - Intergenic
1002049951 5:176565142-176565164 AGGGGGAGGCCAGGTGGGGTAGG - Intronic
1002140020 5:177132813-177132835 GGGGGAAGGGAAGGGGTGGTGGG + Intergenic
1002161335 5:177315464-177315486 AGGGGTAGGGAAGGGCTGGTGGG + Intergenic
1002541068 5:179907152-179907174 AGGAGCAGGAAAGGTGGGGGAGG + Intronic
1002701556 5:181128496-181128518 AGTGGAAGGAAAGGCGTGGGTGG - Intergenic
1004188713 6:13445852-13445874 AGGTGTAGGACAGCTGAGGTTGG - Intronic
1004321369 6:14634089-14634111 AGGGCCACGAAAGGTGTGGCTGG + Intergenic
1005169057 6:22960446-22960468 ATGAGAAGGAAAAGTGTGGTGGG + Intergenic
1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG + Intronic
1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG + Intergenic
1006031385 6:31179182-31179204 AGGTGAAGGCAGGGTGTGGTGGG - Intronic
1006452612 6:34113911-34113933 AGGGGAGGGGAAGGTGTGGCAGG - Intronic
1007106707 6:39288368-39288390 AGGGGCAAGTAAGGTGAGGTTGG + Intergenic
1007320641 6:41026621-41026643 AAGGGTAGGAGAGGACTGGTGGG + Intergenic
1007906046 6:45461699-45461721 AAGGGCAGGAAATGTGTGGGAGG + Intronic
1011038330 6:83002039-83002061 AGGGCTTGGGAAGGTGGGGTGGG - Intronic
1011111585 6:83842888-83842910 AGAGGTAAGAAAGATTTGGTTGG + Intergenic
1012401557 6:98845835-98845857 AGGGAAAGGAAAGGAGGGGTGGG - Intergenic
1013995518 6:116303649-116303671 AGGGGTAGGGGAGGGCTGGTTGG + Intronic
1015206263 6:130643060-130643082 AGGGGTAGGAAAGGTAGGGATGG - Intergenic
1015995664 6:138993402-138993424 AGAGGTTGGAAAAGTGTGGAGGG + Intergenic
1016081493 6:139862599-139862621 AGAGGTAGAAAAGGAGTGGGAGG - Intergenic
1018575880 6:165259579-165259601 AGAGGTAGGAAGAGTGTGGAGGG - Intergenic
1018767274 6:166944477-166944499 TGGGGCAGGAGAGGTGGGGTGGG - Intronic
1018953074 6:168391579-168391601 AGGGATAGGACAGGTGTGCTGGG - Intergenic
1018953095 6:168391660-168391682 AGGGACAGGACAGGTGTGCTGGG - Intergenic
1018953108 6:168391714-168391736 AGGGACAGGACAGGTGTGCTGGG - Intergenic
1018953121 6:168391768-168391790 AGGGACAGGACAGGTGTGCTGGG - Intergenic
1018953174 6:168391958-168391980 AGGGACAGGACAGGTGTGCTGGG - Intergenic
1018953252 6:168392254-168392276 AGGGACAGGACAGGTGTGCTGGG - Intergenic
1018953259 6:168392282-168392304 AGGGACAGGACAGGTGTGCTGGG - Intergenic
1018953273 6:168392337-168392359 AGGGATGGGACAGGTGTGCTGGG - Intergenic
1018953281 6:168392365-168392387 AGGGACAGGACAGGTGTGCTGGG - Intergenic
1019477133 7:1249507-1249529 AGGGGAAGGAAAGGGGGGGCTGG + Intergenic
1022194732 7:28053853-28053875 TGGGGTGGGAAAGGTGAGGATGG - Intronic
1022527829 7:31049756-31049778 AGGGGTAGGGTGGGAGTGGTAGG + Intergenic
1024209847 7:47193893-47193915 AGGGCAGGGAAGGGTGTGGTGGG - Intergenic
1024574243 7:50751128-50751150 AGGGGTAGGAGTGGTGAGGAGGG - Intronic
1026867991 7:73835012-73835034 AGGGGTAGGTGAGGTGGGGGAGG + Intronic
1027184950 7:75965503-75965525 AGGGGATGGAAAGGAGGGGTGGG - Intronic
1027189364 7:75988638-75988660 AGGGGAAGGCCAGGTGGGGTGGG + Intronic
1027340559 7:77203162-77203184 AGGGGTAGGAAAGGAGATGGAGG + Intronic
1027773278 7:82433731-82433753 AAGGGTGGGGAAGGTGTGGAAGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028326854 7:89538831-89538853 AGAAGTAGGAAAGGTGTGAATGG - Intergenic
1029327527 7:99823076-99823098 GGGGTGAGGAAAGGTGGGGTGGG - Intergenic
1029412879 7:100426937-100426959 AGGGGGAGGAAAGGGGAGGGAGG - Intronic
1029412939 7:100427107-100427129 AGGGGGAGGAAAGGGGAGGGAGG - Intronic
1030108587 7:106007756-106007778 AGGGGTTGGAACAGTTTGGTGGG - Intronic
1031533475 7:122905542-122905564 AGGGGAAGGAATGGTGAGGAAGG - Intergenic
1032622800 7:133554700-133554722 TGGGATAGGAAAGGTCAGGTGGG - Intronic
1032740200 7:134730906-134730928 TGAGGTAGGATAGGTGGGGTGGG - Intergenic
1033198063 7:139344041-139344063 AGGGGCAGGAAAGGTGAGATGGG - Intronic
1033324732 7:140368108-140368130 AGTGGTAAGAAAGGTGGGGCTGG - Intronic
1033457118 7:141512395-141512417 ACGGGAAGGAAAGGGGTTGTAGG - Intergenic
1033487107 7:141801725-141801747 AGGAGTAGGAAAGGGGAGGAGGG + Intergenic
1035422007 7:158737525-158737547 AGGGGTAGGCACTGTGGGGTGGG - Intronic
1037058009 8:14469101-14469123 AGGGGTAGGAAAAGTGGTGGTGG - Intronic
1040325066 8:46337481-46337503 AAGGGGAGGCAAGGTGGGGTGGG + Intergenic
1040845574 8:51834851-51834873 AAGGGTATAAAAGGTGGGGTGGG + Intronic
1041007320 8:53508032-53508054 AGGGGTGGGAAGTGGGTGGTGGG - Intergenic
1041397168 8:57403129-57403151 GAGGGTAGGAGAGGTGTTGTAGG + Intergenic
1041932067 8:63297780-63297802 AGAGTCAGGAAAGGTGTGGCAGG - Intergenic
1042844379 8:73155754-73155776 AGGGGGAGGAAAGGCCAGGTGGG + Intergenic
1043584303 8:81749498-81749520 AGGCATAGGAGAGGTGAGGTAGG + Intronic
1043636219 8:82386444-82386466 AGAGTTAGGAAATGTGTGGCTGG - Intergenic
1044371576 8:91418387-91418409 AGGGCTAGGAAAGGTAAGGTGGG + Intergenic
1044706166 8:95010829-95010851 AGGTGTGGGAAAGGTTTTGTGGG + Intronic
1045835263 8:106513222-106513244 AGGAGCAGGAAAGGCCTGGTAGG - Intronic
1045840056 8:106569535-106569557 AGGGTTTGGAAAGTTGTCGTGGG - Intronic
1047516304 8:125557354-125557376 AGGTGCAGGAAAGGTGGGGAGGG + Intergenic
1047743996 8:127830329-127830351 AGTGGAGGGAGAGGTGTGGTTGG + Intergenic
1048739366 8:137537604-137537626 AGGGGTAGGAAAGGTACTGATGG + Intergenic
1049714548 8:144083632-144083654 AGGGCTAGGAAAGTTGTGGGGGG + Intronic
1049812195 8:144580595-144580617 AGGAGTAGGTCAGGTATGGTGGG - Intronic
1052236852 9:26220977-26220999 AGGGGTAGGAATGGGGTAGTGGG - Intergenic
1053389417 9:37723544-37723566 AGGGGCAGGAAAGCTGTGACTGG + Intronic
1053522195 9:38791504-38791526 AGGGATAGGAAGTGTGTGGAGGG - Intergenic
1054194422 9:62015968-62015990 AGGGATAGGAAGTGTGTGGAGGG - Intergenic
1054643985 9:67572722-67572744 AGGGATAGGAAGTGTGTGGAGGG + Intergenic
1054806869 9:69404012-69404034 ATGGGCAGGAAAGGGGTGGCAGG + Intergenic
1057845171 9:98517303-98517325 AGGGGTGGGAAAGGTGGGACTGG - Intronic
1058314909 9:103553793-103553815 AGGGGCAGGAAGTGAGTGGTAGG + Intergenic
1058797994 9:108516986-108517008 AGGGGTAGGATGTGTGTGGGGGG - Intergenic
1059437188 9:114283945-114283967 ATGGATGGGACAGGTGTGGTTGG + Intronic
1060367137 9:123028504-123028526 AGGGGTTGGATAGTTGGGGTGGG + Intronic
1060943890 9:127558591-127558613 AGGGCTAGGGGAGGTGTGGTAGG + Intronic
1061315132 9:129790698-129790720 AGGCCTGGGAAAGGTGTGGAAGG - Intergenic
1061574147 9:131495652-131495674 AGGAGCAGGAAGGGAGTGGTGGG + Intronic
1187737010 X:22315016-22315038 AGGGGGAGGAAAGGTGCGAGAGG - Intergenic
1187829627 X:23367676-23367698 AGTGGGAGCATAGGTGTGGTTGG + Intronic
1190264901 X:48822583-48822605 AGGGGAGGGAAAGGTATGGTGGG - Intronic
1190818181 X:53947616-53947638 ATCAGTAGGAAAGGTGTGATGGG - Intronic
1192264483 X:69529542-69529564 ATGGATAAGGAAGGTGTGGTGGG - Intronic
1193724915 X:85026892-85026914 AGAGGTTGGAAAAGTGTGGAGGG - Intronic
1193733254 X:85126844-85126866 TGGGGTGGGAGGGGTGTGGTGGG - Intergenic
1193796837 X:85887590-85887612 AGGGGTTGGAACAGTTTGGTGGG + Intronic
1196126014 X:112099586-112099608 GTGGGTGGGGAAGGTGTGGTAGG + Intergenic
1196197217 X:112848843-112848865 GGGGGTAGGAAAGGGGTGCCGGG - Intergenic
1197198102 X:123723873-123723895 AGAGGTGGGAAAGGTTTGATCGG + Intronic
1199639149 X:149842902-149842924 AGAGGTTGGAAGAGTGTGGTGGG - Intergenic
1199642819 X:149880953-149880975 AGTGGGGGGAAGGGTGTGGTGGG - Intergenic
1199874197 X:151918845-151918867 GGGGGTGGGAAGGGTGAGGTCGG - Intronic
1199874354 X:151919445-151919467 GGGGGTGGGAGAGGTGAGGTTGG - Intronic
1201183135 Y:11369590-11369612 AGAGGTAGGAAATGTGTGGAAGG - Intergenic
1201303067 Y:12526940-12526962 AGGGCTGGGAAAGATGGGGTGGG - Intergenic