ID: 1005976501

View in Genome Browser
Species Human (GRCh38)
Location 6:30804125-30804147
Sequence TTCACACAAGAACCCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005976501_1005976505 19 Left 1005976501 6:30804125-30804147 CCCCTCTGGGGTTCTTGTGTGAA No data
Right 1005976505 6:30804167-30804189 CCTTTGATTACATGAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005976501 Original CRISPR TTCACACAAGAACCCCAGAG GGG (reversed) Intergenic
No off target data available for this crispr