ID: 1005978840

View in Genome Browser
Species Human (GRCh38)
Location 6:30820475-30820497
Sequence AGAGTTATGAGAGGTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005978836_1005978840 -9 Left 1005978836 6:30820461-30820483 CCCAAGCTCTCTGCAGAGTTATG No data
Right 1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG No data
1005978835_1005978840 -8 Left 1005978835 6:30820460-30820482 CCCCAAGCTCTCTGCAGAGTTAT No data
Right 1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG No data
1005978837_1005978840 -10 Left 1005978837 6:30820462-30820484 CCAAGCTCTCTGCAGAGTTATGA No data
Right 1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005978840 Original CRISPR AGAGTTATGAGAGGTGTGGT TGG Intergenic
No off target data available for this crispr